ID: 1082193488

View in Genome Browser
Species Human (GRCh38)
Location 11:49274249-49274271
Sequence GAGCTGCTTGGAGAAGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082193488_1082193492 2 Left 1082193488 11:49274249-49274271 CCTGACACTTCTCCAAGCAGCTC No data
Right 1082193492 11:49274274-49274296 CATGCCAGCTCGGATGTATATGG No data
1082193488_1082193496 12 Left 1082193488 11:49274249-49274271 CCTGACACTTCTCCAAGCAGCTC No data
Right 1082193496 11:49274284-49274306 CGGATGTATATGGCGGTCATGGG No data
1082193488_1082193493 5 Left 1082193488 11:49274249-49274271 CCTGACACTTCTCCAAGCAGCTC No data
Right 1082193493 11:49274277-49274299 GCCAGCTCGGATGTATATGGCGG No data
1082193488_1082193497 13 Left 1082193488 11:49274249-49274271 CCTGACACTTCTCCAAGCAGCTC No data
Right 1082193497 11:49274285-49274307 GGATGTATATGGCGGTCATGGGG No data
1082193488_1082193490 -8 Left 1082193488 11:49274249-49274271 CCTGACACTTCTCCAAGCAGCTC No data
Right 1082193490 11:49274264-49274286 AGCAGCTCTCCATGCCAGCTCGG No data
1082193488_1082193495 11 Left 1082193488 11:49274249-49274271 CCTGACACTTCTCCAAGCAGCTC No data
Right 1082193495 11:49274283-49274305 TCGGATGTATATGGCGGTCATGG No data
1082193488_1082193498 23 Left 1082193488 11:49274249-49274271 CCTGACACTTCTCCAAGCAGCTC No data
Right 1082193498 11:49274295-49274317 GGCGGTCATGGGGATTCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082193488 Original CRISPR GAGCTGCTTGGAGAAGTGTC AGG (reversed) Intergenic