ID: 1082193489

View in Genome Browser
Species Human (GRCh38)
Location 11:49274261-49274283
Sequence AGCTGGCATGGAGAGCTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082193489_1082193496 0 Left 1082193489 11:49274261-49274283 CCAAGCAGCTCTCCATGCCAGCT No data
Right 1082193496 11:49274284-49274306 CGGATGTATATGGCGGTCATGGG No data
1082193489_1082193493 -7 Left 1082193489 11:49274261-49274283 CCAAGCAGCTCTCCATGCCAGCT No data
Right 1082193493 11:49274277-49274299 GCCAGCTCGGATGTATATGGCGG No data
1082193489_1082193495 -1 Left 1082193489 11:49274261-49274283 CCAAGCAGCTCTCCATGCCAGCT No data
Right 1082193495 11:49274283-49274305 TCGGATGTATATGGCGGTCATGG No data
1082193489_1082193499 26 Left 1082193489 11:49274261-49274283 CCAAGCAGCTCTCCATGCCAGCT No data
Right 1082193499 11:49274310-49274332 TCCTATGGTTAATATTCTAGAGG No data
1082193489_1082193492 -10 Left 1082193489 11:49274261-49274283 CCAAGCAGCTCTCCATGCCAGCT No data
Right 1082193492 11:49274274-49274296 CATGCCAGCTCGGATGTATATGG No data
1082193489_1082193497 1 Left 1082193489 11:49274261-49274283 CCAAGCAGCTCTCCATGCCAGCT No data
Right 1082193497 11:49274285-49274307 GGATGTATATGGCGGTCATGGGG No data
1082193489_1082193498 11 Left 1082193489 11:49274261-49274283 CCAAGCAGCTCTCCATGCCAGCT No data
Right 1082193498 11:49274295-49274317 GGCGGTCATGGGGATTCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082193489 Original CRISPR AGCTGGCATGGAGAGCTGCT TGG (reversed) Intergenic