ID: 1082193490

View in Genome Browser
Species Human (GRCh38)
Location 11:49274264-49274286
Sequence AGCAGCTCTCCATGCCAGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082193488_1082193490 -8 Left 1082193488 11:49274249-49274271 CCTGACACTTCTCCAAGCAGCTC No data
Right 1082193490 11:49274264-49274286 AGCAGCTCTCCATGCCAGCTCGG No data
1082193484_1082193490 14 Left 1082193484 11:49274227-49274249 CCCCAAAGGCTGGAGTCTTGTCC No data
Right 1082193490 11:49274264-49274286 AGCAGCTCTCCATGCCAGCTCGG No data
1082193486_1082193490 12 Left 1082193486 11:49274229-49274251 CCAAAGGCTGGAGTCTTGTCCCT No data
Right 1082193490 11:49274264-49274286 AGCAGCTCTCCATGCCAGCTCGG No data
1082193478_1082193490 24 Left 1082193478 11:49274217-49274239 CCCCCCAGTTCCCCAAAGGCTGG No data
Right 1082193490 11:49274264-49274286 AGCAGCTCTCCATGCCAGCTCGG No data
1082193485_1082193490 13 Left 1082193485 11:49274228-49274250 CCCAAAGGCTGGAGTCTTGTCCC No data
Right 1082193490 11:49274264-49274286 AGCAGCTCTCCATGCCAGCTCGG No data
1082193481_1082193490 22 Left 1082193481 11:49274219-49274241 CCCCAGTTCCCCAAAGGCTGGAG No data
Right 1082193490 11:49274264-49274286 AGCAGCTCTCCATGCCAGCTCGG No data
1082193483_1082193490 20 Left 1082193483 11:49274221-49274243 CCAGTTCCCCAAAGGCTGGAGTC No data
Right 1082193490 11:49274264-49274286 AGCAGCTCTCCATGCCAGCTCGG No data
1082193480_1082193490 23 Left 1082193480 11:49274218-49274240 CCCCCAGTTCCCCAAAGGCTGGA No data
Right 1082193490 11:49274264-49274286 AGCAGCTCTCCATGCCAGCTCGG No data
1082193476_1082193490 30 Left 1082193476 11:49274211-49274233 CCAACACCCCCCAGTTCCCCAAA No data
Right 1082193490 11:49274264-49274286 AGCAGCTCTCCATGCCAGCTCGG No data
1082193487_1082193490 -7 Left 1082193487 11:49274248-49274270 CCCTGACACTTCTCCAAGCAGCT No data
Right 1082193490 11:49274264-49274286 AGCAGCTCTCCATGCCAGCTCGG No data
1082193482_1082193490 21 Left 1082193482 11:49274220-49274242 CCCAGTTCCCCAAAGGCTGGAGT No data
Right 1082193490 11:49274264-49274286 AGCAGCTCTCCATGCCAGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082193490 Original CRISPR AGCAGCTCTCCATGCCAGCT CGG Intergenic
No off target data available for this crispr