ID: 1082193491

View in Genome Browser
Species Human (GRCh38)
Location 11:49274273-49274295
Sequence CATATACATCCGAGCTGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082193491_1082193498 -1 Left 1082193491 11:49274273-49274295 CCATGCCAGCTCGGATGTATATG No data
Right 1082193498 11:49274295-49274317 GGCGGTCATGGGGATTCCTATGG No data
1082193491_1082193501 21 Left 1082193491 11:49274273-49274295 CCATGCCAGCTCGGATGTATATG No data
Right 1082193501 11:49274317-49274339 GTTAATATTCTAGAGGTCCGTGG No data
1082193491_1082193499 14 Left 1082193491 11:49274273-49274295 CCATGCCAGCTCGGATGTATATG No data
Right 1082193499 11:49274310-49274332 TCCTATGGTTAATATTCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082193491 Original CRISPR CATATACATCCGAGCTGGCA TGG (reversed) Intergenic