ID: 1082193492

View in Genome Browser
Species Human (GRCh38)
Location 11:49274274-49274296
Sequence CATGCCAGCTCGGATGTATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082193484_1082193492 24 Left 1082193484 11:49274227-49274249 CCCCAAAGGCTGGAGTCTTGTCC No data
Right 1082193492 11:49274274-49274296 CATGCCAGCTCGGATGTATATGG No data
1082193485_1082193492 23 Left 1082193485 11:49274228-49274250 CCCAAAGGCTGGAGTCTTGTCCC No data
Right 1082193492 11:49274274-49274296 CATGCCAGCTCGGATGTATATGG No data
1082193487_1082193492 3 Left 1082193487 11:49274248-49274270 CCCTGACACTTCTCCAAGCAGCT No data
Right 1082193492 11:49274274-49274296 CATGCCAGCTCGGATGTATATGG No data
1082193488_1082193492 2 Left 1082193488 11:49274249-49274271 CCTGACACTTCTCCAAGCAGCTC No data
Right 1082193492 11:49274274-49274296 CATGCCAGCTCGGATGTATATGG No data
1082193489_1082193492 -10 Left 1082193489 11:49274261-49274283 CCAAGCAGCTCTCCATGCCAGCT No data
Right 1082193492 11:49274274-49274296 CATGCCAGCTCGGATGTATATGG No data
1082193483_1082193492 30 Left 1082193483 11:49274221-49274243 CCAGTTCCCCAAAGGCTGGAGTC No data
Right 1082193492 11:49274274-49274296 CATGCCAGCTCGGATGTATATGG No data
1082193486_1082193492 22 Left 1082193486 11:49274229-49274251 CCAAAGGCTGGAGTCTTGTCCCT No data
Right 1082193492 11:49274274-49274296 CATGCCAGCTCGGATGTATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082193492 Original CRISPR CATGCCAGCTCGGATGTATA TGG Intergenic
No off target data available for this crispr