ID: 1082193493

View in Genome Browser
Species Human (GRCh38)
Location 11:49274277-49274299
Sequence GCCAGCTCGGATGTATATGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082193486_1082193493 25 Left 1082193486 11:49274229-49274251 CCAAAGGCTGGAGTCTTGTCCCT No data
Right 1082193493 11:49274277-49274299 GCCAGCTCGGATGTATATGGCGG No data
1082193488_1082193493 5 Left 1082193488 11:49274249-49274271 CCTGACACTTCTCCAAGCAGCTC No data
Right 1082193493 11:49274277-49274299 GCCAGCTCGGATGTATATGGCGG No data
1082193485_1082193493 26 Left 1082193485 11:49274228-49274250 CCCAAAGGCTGGAGTCTTGTCCC No data
Right 1082193493 11:49274277-49274299 GCCAGCTCGGATGTATATGGCGG No data
1082193487_1082193493 6 Left 1082193487 11:49274248-49274270 CCCTGACACTTCTCCAAGCAGCT No data
Right 1082193493 11:49274277-49274299 GCCAGCTCGGATGTATATGGCGG No data
1082193484_1082193493 27 Left 1082193484 11:49274227-49274249 CCCCAAAGGCTGGAGTCTTGTCC No data
Right 1082193493 11:49274277-49274299 GCCAGCTCGGATGTATATGGCGG No data
1082193489_1082193493 -7 Left 1082193489 11:49274261-49274283 CCAAGCAGCTCTCCATGCCAGCT No data
Right 1082193493 11:49274277-49274299 GCCAGCTCGGATGTATATGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082193493 Original CRISPR GCCAGCTCGGATGTATATGG CGG Intergenic
No off target data available for this crispr