ID: 1082193494

View in Genome Browser
Species Human (GRCh38)
Location 11:49274278-49274300
Sequence ACCGCCATATACATCCGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082193494_1082193501 16 Left 1082193494 11:49274278-49274300 CCAGCTCGGATGTATATGGCGGT No data
Right 1082193501 11:49274317-49274339 GTTAATATTCTAGAGGTCCGTGG No data
1082193494_1082193503 28 Left 1082193494 11:49274278-49274300 CCAGCTCGGATGTATATGGCGGT No data
Right 1082193503 11:49274329-49274351 GAGGTCCGTGGTAAGTCCATGGG No data
1082193494_1082193498 -6 Left 1082193494 11:49274278-49274300 CCAGCTCGGATGTATATGGCGGT No data
Right 1082193498 11:49274295-49274317 GGCGGTCATGGGGATTCCTATGG No data
1082193494_1082193499 9 Left 1082193494 11:49274278-49274300 CCAGCTCGGATGTATATGGCGGT No data
Right 1082193499 11:49274310-49274332 TCCTATGGTTAATATTCTAGAGG No data
1082193494_1082193502 27 Left 1082193494 11:49274278-49274300 CCAGCTCGGATGTATATGGCGGT No data
Right 1082193502 11:49274328-49274350 AGAGGTCCGTGGTAAGTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082193494 Original CRISPR ACCGCCATATACATCCGAGC TGG (reversed) Intergenic