ID: 1082193497

View in Genome Browser
Species Human (GRCh38)
Location 11:49274285-49274307
Sequence GGATGTATATGGCGGTCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082193489_1082193497 1 Left 1082193489 11:49274261-49274283 CCAAGCAGCTCTCCATGCCAGCT No data
Right 1082193497 11:49274285-49274307 GGATGTATATGGCGGTCATGGGG No data
1082193487_1082193497 14 Left 1082193487 11:49274248-49274270 CCCTGACACTTCTCCAAGCAGCT No data
Right 1082193497 11:49274285-49274307 GGATGTATATGGCGGTCATGGGG No data
1082193488_1082193497 13 Left 1082193488 11:49274249-49274271 CCTGACACTTCTCCAAGCAGCTC No data
Right 1082193497 11:49274285-49274307 GGATGTATATGGCGGTCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082193497 Original CRISPR GGATGTATATGGCGGTCATG GGG Intergenic
No off target data available for this crispr