ID: 1082193498

View in Genome Browser
Species Human (GRCh38)
Location 11:49274295-49274317
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082193491_1082193498 -1 Left 1082193491 11:49274273-49274295 CCATGCCAGCTCGGATGTATATG No data
Right 1082193498 11:49274295-49274317 GGCGGTCATGGGGATTCCTATGG No data
1082193488_1082193498 23 Left 1082193488 11:49274249-49274271 CCTGACACTTCTCCAAGCAGCTC No data
Right 1082193498 11:49274295-49274317 GGCGGTCATGGGGATTCCTATGG No data
1082193489_1082193498 11 Left 1082193489 11:49274261-49274283 CCAAGCAGCTCTCCATGCCAGCT No data
Right 1082193498 11:49274295-49274317 GGCGGTCATGGGGATTCCTATGG No data
1082193487_1082193498 24 Left 1082193487 11:49274248-49274270 CCCTGACACTTCTCCAAGCAGCT No data
Right 1082193498 11:49274295-49274317 GGCGGTCATGGGGATTCCTATGG No data
1082193494_1082193498 -6 Left 1082193494 11:49274278-49274300 CCAGCTCGGATGTATATGGCGGT No data
Right 1082193498 11:49274295-49274317 GGCGGTCATGGGGATTCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082193498 Original CRISPR GGCGGTCATGGGGATTCCTA TGG Intergenic