ID: 1082196671

View in Genome Browser
Species Human (GRCh38)
Location 11:49315086-49315108
Sequence AAAAGGCATCTGGCTACATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082196671_1082196678 25 Left 1082196671 11:49315086-49315108 CCAAATGTAGCCAGATGCCTTTT No data
Right 1082196678 11:49315134-49315156 CAACCACCACATTAGATCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082196671 Original CRISPR AAAAGGCATCTGGCTACATT TGG (reversed) Intergenic
No off target data available for this crispr