ID: 1082201385

View in Genome Browser
Species Human (GRCh38)
Location 11:49374058-49374080
Sequence ACTCGTTGTATTACAGATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082201385_1082201386 -8 Left 1082201385 11:49374058-49374080 CCTGGATCTGTAATACAACGAGT No data
Right 1082201386 11:49374073-49374095 CAACGAGTGAATAAGCTCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082201385 Original CRISPR ACTCGTTGTATTACAGATCC AGG (reversed) Intergenic
No off target data available for this crispr