ID: 1082205982

View in Genome Browser
Species Human (GRCh38)
Location 11:49434514-49434536
Sequence GGCAGCGTGGAGACAAGACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082205982_1082205996 29 Left 1082205982 11:49434514-49434536 CCGGGTCTTGTCTCCACGCTGCC No data
Right 1082205996 11:49434566-49434588 CGCGCGCGGGCTCCAACGCCCGG No data
1082205982_1082205992 15 Left 1082205982 11:49434514-49434536 CCGGGTCTTGTCTCCACGCTGCC No data
Right 1082205992 11:49434552-49434574 GCAACGCCTCCATGCGCGCGCGG No data
1082205982_1082205988 -7 Left 1082205982 11:49434514-49434536 CCGGGTCTTGTCTCCACGCTGCC No data
Right 1082205988 11:49434530-49434552 CGCTGCCCTCAGGGGGCTGCCGG No data
1082205982_1082205993 16 Left 1082205982 11:49434514-49434536 CCGGGTCTTGTCTCCACGCTGCC No data
Right 1082205993 11:49434553-49434575 CAACGCCTCCATGCGCGCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082205982 Original CRISPR GGCAGCGTGGAGACAAGACC CGG (reversed) Intergenic