ID: 1082205987 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:49434527-49434549 |
| Sequence | GCAGCCCCCTGAGGGCAGCG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1082205987_1082205992 | 2 | Left | 1082205987 | 11:49434527-49434549 | CCACGCTGCCCTCAGGGGGCTGC | No data | ||
| Right | 1082205992 | 11:49434552-49434574 | GCAACGCCTCCATGCGCGCGCGG | No data | ||||
| 1082205987_1082205996 | 16 | Left | 1082205987 | 11:49434527-49434549 | CCACGCTGCCCTCAGGGGGCTGC | No data | ||
| Right | 1082205996 | 11:49434566-49434588 | CGCGCGCGGGCTCCAACGCCCGG | No data | ||||
| 1082205987_1082205993 | 3 | Left | 1082205987 | 11:49434527-49434549 | CCACGCTGCCCTCAGGGGGCTGC | No data | ||
| Right | 1082205993 | 11:49434553-49434575 | CAACGCCTCCATGCGCGCGCGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1082205987 | Original CRISPR | GCAGCCCCCTGAGGGCAGCG TGG (reversed) | Intergenic | ||