ID: 1082205989

View in Genome Browser
Species Human (GRCh38)
Location 11:49434535-49434557
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082205989_1082205993 -5 Left 1082205989 11:49434535-49434557 CCCTCAGGGGGCTGCCGGCAACG No data
Right 1082205993 11:49434553-49434575 CAACGCCTCCATGCGCGCGCGGG No data
1082205989_1082205992 -6 Left 1082205989 11:49434535-49434557 CCCTCAGGGGGCTGCCGGCAACG No data
Right 1082205992 11:49434552-49434574 GCAACGCCTCCATGCGCGCGCGG No data
1082205989_1082205996 8 Left 1082205989 11:49434535-49434557 CCCTCAGGGGGCTGCCGGCAACG No data
Right 1082205996 11:49434566-49434588 CGCGCGCGGGCTCCAACGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082205989 Original CRISPR CGTTGCCGGCAGCCCCCTGA GGG (reversed) Intergenic