ID: 1082205990

View in Genome Browser
Species Human (GRCh38)
Location 11:49434536-49434558
Sequence GCGTTGCCGGCAGCCCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082205990_1082205993 -6 Left 1082205990 11:49434536-49434558 CCTCAGGGGGCTGCCGGCAACGC No data
Right 1082205993 11:49434553-49434575 CAACGCCTCCATGCGCGCGCGGG No data
1082205990_1082205992 -7 Left 1082205990 11:49434536-49434558 CCTCAGGGGGCTGCCGGCAACGC No data
Right 1082205992 11:49434552-49434574 GCAACGCCTCCATGCGCGCGCGG No data
1082205990_1082205996 7 Left 1082205990 11:49434536-49434558 CCTCAGGGGGCTGCCGGCAACGC No data
Right 1082205996 11:49434566-49434588 CGCGCGCGGGCTCCAACGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082205990 Original CRISPR GCGTTGCCGGCAGCCCCCTG AGG (reversed) Intergenic