ID: 1082205991

View in Genome Browser
Species Human (GRCh38)
Location 11:49434549-49434571
Sequence CGCGCGCATGGAGGCGTTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082205991_1082206001 25 Left 1082205991 11:49434549-49434571 CCGGCAACGCCTCCATGCGCGCG No data
Right 1082206001 11:49434597-49434619 AGCCCGCGCCTTCCGCGGCGTGG No data
1082205991_1082205996 -6 Left 1082205991 11:49434549-49434571 CCGGCAACGCCTCCATGCGCGCG No data
Right 1082205996 11:49434566-49434588 CGCGCGCGGGCTCCAACGCCCGG No data
1082205991_1082206000 20 Left 1082205991 11:49434549-49434571 CCGGCAACGCCTCCATGCGCGCG No data
Right 1082206000 11:49434592-49434614 TGCTCAGCCCGCGCCTTCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082205991 Original CRISPR CGCGCGCATGGAGGCGTTGC CGG (reversed) Intergenic