ID: 1082205991 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:49434549-49434571 |
| Sequence | CGCGCGCATGGAGGCGTTGC CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1082205991_1082206001 | 25 | Left | 1082205991 | 11:49434549-49434571 | CCGGCAACGCCTCCATGCGCGCG | No data | ||
| Right | 1082206001 | 11:49434597-49434619 | AGCCCGCGCCTTCCGCGGCGTGG | No data | ||||
| 1082205991_1082205996 | -6 | Left | 1082205991 | 11:49434549-49434571 | CCGGCAACGCCTCCATGCGCGCG | No data | ||
| Right | 1082205996 | 11:49434566-49434588 | CGCGCGCGGGCTCCAACGCCCGG | No data | ||||
| 1082205991_1082206000 | 20 | Left | 1082205991 | 11:49434549-49434571 | CCGGCAACGCCTCCATGCGCGCG | No data | ||
| Right | 1082206000 | 11:49434592-49434614 | TGCTCAGCCCGCGCCTTCCGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1082205991 | Original CRISPR | CGCGCGCATGGAGGCGTTGC CGG (reversed) | Intergenic | ||