ID: 1082205992 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:49434552-49434574 |
Sequence | GCAACGCCTCCATGCGCGCG CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1082205987_1082205992 | 2 | Left | 1082205987 | 11:49434527-49434549 | CCACGCTGCCCTCAGGGGGCTGC | No data | ||
Right | 1082205992 | 11:49434552-49434574 | GCAACGCCTCCATGCGCGCGCGG | No data | ||||
1082205990_1082205992 | -7 | Left | 1082205990 | 11:49434536-49434558 | CCTCAGGGGGCTGCCGGCAACGC | No data | ||
Right | 1082205992 | 11:49434552-49434574 | GCAACGCCTCCATGCGCGCGCGG | No data | ||||
1082205989_1082205992 | -6 | Left | 1082205989 | 11:49434535-49434557 | CCCTCAGGGGGCTGCCGGCAACG | No data | ||
Right | 1082205992 | 11:49434552-49434574 | GCAACGCCTCCATGCGCGCGCGG | No data | ||||
1082205982_1082205992 | 15 | Left | 1082205982 | 11:49434514-49434536 | CCGGGTCTTGTCTCCACGCTGCC | No data | ||
Right | 1082205992 | 11:49434552-49434574 | GCAACGCCTCCATGCGCGCGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1082205992 | Original CRISPR | GCAACGCCTCCATGCGCGCG CGG | Intergenic | ||