ID: 1082205993

View in Genome Browser
Species Human (GRCh38)
Location 11:49434553-49434575
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082205989_1082205993 -5 Left 1082205989 11:49434535-49434557 CCCTCAGGGGGCTGCCGGCAACG No data
Right 1082205993 11:49434553-49434575 CAACGCCTCCATGCGCGCGCGGG No data
1082205982_1082205993 16 Left 1082205982 11:49434514-49434536 CCGGGTCTTGTCTCCACGCTGCC No data
Right 1082205993 11:49434553-49434575 CAACGCCTCCATGCGCGCGCGGG No data
1082205987_1082205993 3 Left 1082205987 11:49434527-49434549 CCACGCTGCCCTCAGGGGGCTGC No data
Right 1082205993 11:49434553-49434575 CAACGCCTCCATGCGCGCGCGGG No data
1082205990_1082205993 -6 Left 1082205990 11:49434536-49434558 CCTCAGGGGGCTGCCGGCAACGC No data
Right 1082205993 11:49434553-49434575 CAACGCCTCCATGCGCGCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082205993 Original CRISPR CAACGCCTCCATGCGCGCGC GGG Intergenic