ID: 1082205996

View in Genome Browser
Species Human (GRCh38)
Location 11:49434566-49434588
Sequence CGCGCGCGGGCTCCAACGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082205987_1082205996 16 Left 1082205987 11:49434527-49434549 CCACGCTGCCCTCAGGGGGCTGC No data
Right 1082205996 11:49434566-49434588 CGCGCGCGGGCTCCAACGCCCGG No data
1082205990_1082205996 7 Left 1082205990 11:49434536-49434558 CCTCAGGGGGCTGCCGGCAACGC No data
Right 1082205996 11:49434566-49434588 CGCGCGCGGGCTCCAACGCCCGG No data
1082205982_1082205996 29 Left 1082205982 11:49434514-49434536 CCGGGTCTTGTCTCCACGCTGCC No data
Right 1082205996 11:49434566-49434588 CGCGCGCGGGCTCCAACGCCCGG No data
1082205991_1082205996 -6 Left 1082205991 11:49434549-49434571 CCGGCAACGCCTCCATGCGCGCG No data
Right 1082205996 11:49434566-49434588 CGCGCGCGGGCTCCAACGCCCGG No data
1082205989_1082205996 8 Left 1082205989 11:49434535-49434557 CCCTCAGGGGGCTGCCGGCAACG No data
Right 1082205996 11:49434566-49434588 CGCGCGCGGGCTCCAACGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082205996 Original CRISPR CGCGCGCGGGCTCCAACGCC CGG Intergenic
No off target data available for this crispr