ID: 1082206002

View in Genome Browser
Species Human (GRCh38)
Location 11:49434599-49434621
Sequence GGCCACGCCGCGGAAGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082206002_1082206013 13 Left 1082206002 11:49434599-49434621 CCCGCGCCTTCCGCGGCGTGGCC No data
Right 1082206013 11:49434635-49434657 CGGCCTCTGCGGCGCGAGCCCGG No data
1082206002_1082206016 17 Left 1082206002 11:49434599-49434621 CCCGCGCCTTCCGCGGCGTGGCC No data
Right 1082206016 11:49434639-49434661 CTCTGCGGCGCGAGCCCGGCGGG No data
1082206002_1082206006 -7 Left 1082206002 11:49434599-49434621 CCCGCGCCTTCCGCGGCGTGGCC No data
Right 1082206006 11:49434615-49434637 CGTGGCCGCCCGCGCCTCACCGG No data
1082206002_1082206018 19 Left 1082206002 11:49434599-49434621 CCCGCGCCTTCCGCGGCGTGGCC No data
Right 1082206018 11:49434641-49434663 CTGCGGCGCGAGCCCGGCGGGGG No data
1082206002_1082206017 18 Left 1082206002 11:49434599-49434621 CCCGCGCCTTCCGCGGCGTGGCC No data
Right 1082206017 11:49434640-49434662 TCTGCGGCGCGAGCCCGGCGGGG No data
1082206002_1082206010 2 Left 1082206002 11:49434599-49434621 CCCGCGCCTTCCGCGGCGTGGCC No data
Right 1082206010 11:49434624-49434646 CCGCGCCTCACCGGCCTCTGCGG No data
1082206002_1082206015 16 Left 1082206002 11:49434599-49434621 CCCGCGCCTTCCGCGGCGTGGCC No data
Right 1082206015 11:49434638-49434660 CCTCTGCGGCGCGAGCCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082206002 Original CRISPR GGCCACGCCGCGGAAGGCGC GGG (reversed) Intergenic
No off target data available for this crispr