ID: 1082207454

View in Genome Browser
Species Human (GRCh38)
Location 11:49455155-49455177
Sequence CTGTAGCTAAGGAGGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082207449_1082207454 -5 Left 1082207449 11:49455137-49455159 CCAGAAGATGTAATTAATCTGTA No data
Right 1082207454 11:49455155-49455177 CTGTAGCTAAGGAGGGAGGCAGG No data
1082207448_1082207454 26 Left 1082207448 11:49455106-49455128 CCTCACTAGAAAATACAGCAAAA No data
Right 1082207454 11:49455155-49455177 CTGTAGCTAAGGAGGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082207454 Original CRISPR CTGTAGCTAAGGAGGGAGGC AGG Intergenic
No off target data available for this crispr