ID: 1082209927

View in Genome Browser
Species Human (GRCh38)
Location 11:49486847-49486869
Sequence GAGCACACCATTACAAAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082209927_1082209928 -1 Left 1082209927 11:49486847-49486869 CCATACTTTGTAATGGTGTGCTC No data
Right 1082209928 11:49486869-49486891 CTAAATAAGAAAACCAGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082209927 Original CRISPR GAGCACACCATTACAAAGTA TGG (reversed) Intergenic
No off target data available for this crispr