ID: 1082211674

View in Genome Browser
Species Human (GRCh38)
Location 11:49510677-49510699
Sequence AATAAGAAGTCCAAAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082211668_1082211674 28 Left 1082211668 11:49510626-49510648 CCCTTGTAGGGTTATTAATTGGC 0: 156
1: 431
2: 553
3: 501
4: 433
Right 1082211674 11:49510677-49510699 AATAAGAAGTCCAAAGAGGAGGG No data
1082211669_1082211674 27 Left 1082211669 11:49510627-49510649 CCTTGTAGGGTTATTAATTGGCT No data
Right 1082211674 11:49510677-49510699 AATAAGAAGTCCAAAGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082211674 Original CRISPR AATAAGAAGTCCAAAGAGGA GGG Intergenic
No off target data available for this crispr