ID: 1082216631

View in Genome Browser
Species Human (GRCh38)
Location 11:49578367-49578389
Sequence CCTGATCTTCTGAAGCTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082216631_1082216638 23 Left 1082216631 11:49578367-49578389 CCTTCTAGCTTCAGAAGATCAGG No data
Right 1082216638 11:49578413-49578435 CTAAATCAATTGTGCCCCAAGGG No data
1082216631_1082216636 -6 Left 1082216631 11:49578367-49578389 CCTTCTAGCTTCAGAAGATCAGG No data
Right 1082216636 11:49578384-49578406 ATCAGGGCTTGGTCACGGTGTGG No data
1082216631_1082216637 22 Left 1082216631 11:49578367-49578389 CCTTCTAGCTTCAGAAGATCAGG No data
Right 1082216637 11:49578412-49578434 GCTAAATCAATTGTGCCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082216631 Original CRISPR CCTGATCTTCTGAAGCTAGA AGG (reversed) Intergenic
No off target data available for this crispr