ID: 1082216636

View in Genome Browser
Species Human (GRCh38)
Location 11:49578384-49578406
Sequence ATCAGGGCTTGGTCACGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082216630_1082216636 -5 Left 1082216630 11:49578366-49578388 CCCTTCTAGCTTCAGAAGATCAG No data
Right 1082216636 11:49578384-49578406 ATCAGGGCTTGGTCACGGTGTGG No data
1082216631_1082216636 -6 Left 1082216631 11:49578367-49578389 CCTTCTAGCTTCAGAAGATCAGG No data
Right 1082216636 11:49578384-49578406 ATCAGGGCTTGGTCACGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082216636 Original CRISPR ATCAGGGCTTGGTCACGGTG TGG Intergenic
No off target data available for this crispr