ID: 1082216638

View in Genome Browser
Species Human (GRCh38)
Location 11:49578413-49578435
Sequence CTAAATCAATTGTGCCCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082216631_1082216638 23 Left 1082216631 11:49578367-49578389 CCTTCTAGCTTCAGAAGATCAGG No data
Right 1082216638 11:49578413-49578435 CTAAATCAATTGTGCCCCAAGGG No data
1082216630_1082216638 24 Left 1082216630 11:49578366-49578388 CCCTTCTAGCTTCAGAAGATCAG No data
Right 1082216638 11:49578413-49578435 CTAAATCAATTGTGCCCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082216638 Original CRISPR CTAAATCAATTGTGCCCCAA GGG Intergenic
No off target data available for this crispr