ID: 1082216917

View in Genome Browser
Species Human (GRCh38)
Location 11:49582560-49582582
Sequence TTTCCAGAAGGAACAGCCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082216911_1082216917 -10 Left 1082216911 11:49582547-49582569 CCCTCCTCTTCCCTTTCCAGAAG No data
Right 1082216917 11:49582560-49582582 TTTCCAGAAGGAACAGCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082216917 Original CRISPR TTTCCAGAAGGAACAGCCTA TGG Intergenic
No off target data available for this crispr