ID: 1082218250

View in Genome Browser
Species Human (GRCh38)
Location 11:49601025-49601047
Sequence GCACCCTCCTGTACTATTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082218250_1082218253 19 Left 1082218250 11:49601025-49601047 CCCATAATAGTACAGGAGGGTGC No data
Right 1082218253 11:49601067-49601089 AAGTATAATACATCACTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082218250 Original CRISPR GCACCCTCCTGTACTATTAT GGG (reversed) Intergenic