ID: 1082219740

View in Genome Browser
Species Human (GRCh38)
Location 11:49619911-49619933
Sequence AGTGTCTTTAAATAGAAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082219738_1082219740 2 Left 1082219738 11:49619886-49619908 CCAAGAAGAGCTCTGTCTGAAGG No data
Right 1082219740 11:49619911-49619933 AGTGTCTTTAAATAGAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082219740 Original CRISPR AGTGTCTTTAAATAGAAGAG AGG Intergenic