ID: 1082224017

View in Genome Browser
Species Human (GRCh38)
Location 11:49679443-49679465
Sequence TTCGTTATGTACTAAATGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082224015_1082224017 5 Left 1082224015 11:49679415-49679437 CCCTTTTCTATTTCTCAACATTT No data
Right 1082224017 11:49679443-49679465 TTCGTTATGTACTAAATGTCAGG No data
1082224016_1082224017 4 Left 1082224016 11:49679416-49679438 CCTTTTCTATTTCTCAACATTTG No data
Right 1082224017 11:49679443-49679465 TTCGTTATGTACTAAATGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082224017 Original CRISPR TTCGTTATGTACTAAATGTC AGG Intergenic
No off target data available for this crispr