ID: 1082235090

View in Genome Browser
Species Human (GRCh38)
Location 11:49814435-49814457
Sequence GTGGACACCCCCTGCGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082235090_1082235101 17 Left 1082235090 11:49814435-49814457 CCCATATCGCAGGGGGTGTCCAC No data
Right 1082235101 11:49814475-49814497 TTCTTATGTGCAAGGGGGAGAGG No data
1082235090_1082235099 11 Left 1082235090 11:49814435-49814457 CCCATATCGCAGGGGGTGTCCAC No data
Right 1082235099 11:49814469-49814491 CACTGTTTCTTATGTGCAAGGGG No data
1082235090_1082235097 9 Left 1082235090 11:49814435-49814457 CCCATATCGCAGGGGGTGTCCAC No data
Right 1082235097 11:49814467-49814489 CACACTGTTTCTTATGTGCAAGG No data
1082235090_1082235100 12 Left 1082235090 11:49814435-49814457 CCCATATCGCAGGGGGTGTCCAC No data
Right 1082235100 11:49814470-49814492 ACTGTTTCTTATGTGCAAGGGGG No data
1082235090_1082235098 10 Left 1082235090 11:49814435-49814457 CCCATATCGCAGGGGGTGTCCAC No data
Right 1082235098 11:49814468-49814490 ACACTGTTTCTTATGTGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082235090 Original CRISPR GTGGACACCCCCTGCGATAT GGG (reversed) Intergenic
No off target data available for this crispr