ID: 1082239422

View in Genome Browser
Species Human (GRCh38)
Location 11:49855276-49855298
Sequence TCTTTTGGAGTGGGCAGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082239414_1082239422 13 Left 1082239414 11:49855240-49855262 CCACCTTGGCGAGCCCAGGCTCT No data
Right 1082239422 11:49855276-49855298 TCTTTTGGAGTGGGCAGCAGAGG No data
1082239417_1082239422 0 Left 1082239417 11:49855253-49855275 CCCAGGCTCTTGGTTTCTTATTA No data
Right 1082239422 11:49855276-49855298 TCTTTTGGAGTGGGCAGCAGAGG No data
1082239411_1082239422 23 Left 1082239411 11:49855230-49855252 CCTCTTTCCTCCACCTTGGCGAG No data
Right 1082239422 11:49855276-49855298 TCTTTTGGAGTGGGCAGCAGAGG No data
1082239418_1082239422 -1 Left 1082239418 11:49855254-49855276 CCAGGCTCTTGGTTTCTTATTAT No data
Right 1082239422 11:49855276-49855298 TCTTTTGGAGTGGGCAGCAGAGG No data
1082239409_1082239422 28 Left 1082239409 11:49855225-49855247 CCAAACCTCTTTCCTCCACCTTG No data
Right 1082239422 11:49855276-49855298 TCTTTTGGAGTGGGCAGCAGAGG No data
1082239413_1082239422 16 Left 1082239413 11:49855237-49855259 CCTCCACCTTGGCGAGCCCAGGC No data
Right 1082239422 11:49855276-49855298 TCTTTTGGAGTGGGCAGCAGAGG No data
1082239415_1082239422 10 Left 1082239415 11:49855243-49855265 CCTTGGCGAGCCCAGGCTCTTGG No data
Right 1082239422 11:49855276-49855298 TCTTTTGGAGTGGGCAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082239422 Original CRISPR TCTTTTGGAGTGGGCAGCAG AGG Intergenic