ID: 1082245812

View in Genome Browser
Species Human (GRCh38)
Location 11:49920896-49920918
Sequence TTTTGCTGCTGGTAGTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082245812_1082245816 16 Left 1082245812 11:49920896-49920918 CCAGGACACTACCAGCAGCAAAA No data
Right 1082245816 11:49920935-49920957 CATGATAACCAAGTAATGCAAGG No data
1082245812_1082245817 23 Left 1082245812 11:49920896-49920918 CCAGGACACTACCAGCAGCAAAA No data
Right 1082245817 11:49920942-49920964 ACCAAGTAATGCAAGGTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082245812 Original CRISPR TTTTGCTGCTGGTAGTGTCC TGG (reversed) Intergenic
No off target data available for this crispr