ID: 1082245816

View in Genome Browser
Species Human (GRCh38)
Location 11:49920935-49920957
Sequence CATGATAACCAAGTAATGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082245813_1082245816 5 Left 1082245813 11:49920907-49920929 CCAGCAGCAAAACACACACCCAT No data
Right 1082245816 11:49920935-49920957 CATGATAACCAAGTAATGCAAGG No data
1082245810_1082245816 21 Left 1082245810 11:49920891-49920913 CCAACCCAGGACACTACCAGCAG No data
Right 1082245816 11:49920935-49920957 CATGATAACCAAGTAATGCAAGG No data
1082245812_1082245816 16 Left 1082245812 11:49920896-49920918 CCAGGACACTACCAGCAGCAAAA No data
Right 1082245816 11:49920935-49920957 CATGATAACCAAGTAATGCAAGG No data
1082245809_1082245816 24 Left 1082245809 11:49920888-49920910 CCTCCAACCCAGGACACTACCAG No data
Right 1082245816 11:49920935-49920957 CATGATAACCAAGTAATGCAAGG No data
1082245811_1082245816 17 Left 1082245811 11:49920895-49920917 CCCAGGACACTACCAGCAGCAAA No data
Right 1082245816 11:49920935-49920957 CATGATAACCAAGTAATGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082245816 Original CRISPR CATGATAACCAAGTAATGCA AGG Intergenic
No off target data available for this crispr