ID: 1082245817

View in Genome Browser
Species Human (GRCh38)
Location 11:49920942-49920964
Sequence ACCAAGTAATGCAAGGTCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082245812_1082245817 23 Left 1082245812 11:49920896-49920918 CCAGGACACTACCAGCAGCAAAA No data
Right 1082245817 11:49920942-49920964 ACCAAGTAATGCAAGGTCATAGG No data
1082245813_1082245817 12 Left 1082245813 11:49920907-49920929 CCAGCAGCAAAACACACACCCAT No data
Right 1082245817 11:49920942-49920964 ACCAAGTAATGCAAGGTCATAGG No data
1082245810_1082245817 28 Left 1082245810 11:49920891-49920913 CCAACCCAGGACACTACCAGCAG No data
Right 1082245817 11:49920942-49920964 ACCAAGTAATGCAAGGTCATAGG No data
1082245815_1082245817 -7 Left 1082245815 11:49920926-49920948 CCATTGTCTCATGATAACCAAGT No data
Right 1082245817 11:49920942-49920964 ACCAAGTAATGCAAGGTCATAGG No data
1082245814_1082245817 -6 Left 1082245814 11:49920925-49920947 CCCATTGTCTCATGATAACCAAG No data
Right 1082245817 11:49920942-49920964 ACCAAGTAATGCAAGGTCATAGG No data
1082245811_1082245817 24 Left 1082245811 11:49920895-49920917 CCCAGGACACTACCAGCAGCAAA No data
Right 1082245817 11:49920942-49920964 ACCAAGTAATGCAAGGTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082245817 Original CRISPR ACCAAGTAATGCAAGGTCAT AGG Intergenic
No off target data available for this crispr