ID: 1082252512

View in Genome Browser
Species Human (GRCh38)
Location 11:49997324-49997346
Sequence TCTGAGCCACTATTGTAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082252512_1082252515 -6 Left 1082252512 11:49997324-49997346 CCATTTTACAATAGTGGCTCAGA No data
Right 1082252515 11:49997341-49997363 CTCAGATTCAATTCTGGCTTGGG No data
1082252512_1082252514 -7 Left 1082252512 11:49997324-49997346 CCATTTTACAATAGTGGCTCAGA No data
Right 1082252514 11:49997340-49997362 GCTCAGATTCAATTCTGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082252512 Original CRISPR TCTGAGCCACTATTGTAAAA TGG (reversed) Intergenic
No off target data available for this crispr