ID: 1082255271

View in Genome Browser
Species Human (GRCh38)
Location 11:50027192-50027214
Sequence CCATTGATTCAGAGGGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082255259_1082255271 29 Left 1082255259 11:50027140-50027162 CCAGCCTCTCCAGCTCTAGTCAT No data
Right 1082255271 11:50027192-50027214 CCATTGATTCAGAGGGTGCAAGG No data
1082255262_1082255271 20 Left 1082255262 11:50027149-50027171 CCAGCTCTAGTCATGGCTAAAAG No data
Right 1082255271 11:50027192-50027214 CCATTGATTCAGAGGGTGCAAGG No data
1082255258_1082255271 30 Left 1082255258 11:50027139-50027161 CCCAGCCTCTCCAGCTCTAGTCA No data
Right 1082255271 11:50027192-50027214 CCATTGATTCAGAGGGTGCAAGG No data
1082255261_1082255271 25 Left 1082255261 11:50027144-50027166 CCTCTCCAGCTCTAGTCATGGCT No data
Right 1082255271 11:50027192-50027214 CCATTGATTCAGAGGGTGCAAGG No data
1082255267_1082255271 -6 Left 1082255267 11:50027175-50027197 CCAAAGTACAGATGAGGCCATTG No data
Right 1082255271 11:50027192-50027214 CCATTGATTCAGAGGGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082255271 Original CRISPR CCATTGATTCAGAGGGTGCA AGG Intergenic
No off target data available for this crispr