ID: 1082255325

View in Genome Browser
Species Human (GRCh38)
Location 11:50027535-50027557
Sequence GTCCCTGTGGCTGCTTTCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 952
Summary {0: 4, 1: 25, 2: 99, 3: 207, 4: 617}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082255325_1082255328 -1 Left 1082255325 11:50027535-50027557 CCTATGAAAGCAGCCACAGGGAC 0: 4
1: 25
2: 99
3: 207
4: 617
Right 1082255328 11:50027557-50027579 CTGTACCCTGCAGAGCCACAGGG 0: 110
1: 1120
2: 1573
3: 1295
4: 1089
1082255325_1082255329 3 Left 1082255325 11:50027535-50027557 CCTATGAAAGCAGCCACAGGGAC 0: 4
1: 25
2: 99
3: 207
4: 617
Right 1082255329 11:50027561-50027583 ACCCTGCAGAGCCACAGGGATGG 0: 11
1: 137
2: 780
3: 1013
4: 1211
1082255325_1082255327 -2 Left 1082255325 11:50027535-50027557 CCTATGAAAGCAGCCACAGGGAC 0: 4
1: 25
2: 99
3: 207
4: 617
Right 1082255327 11:50027556-50027578 ACTGTACCCTGCAGAGCCACAGG 0: 12
1: 220
2: 1268
3: 1713
4: 1558
1082255325_1082255333 15 Left 1082255325 11:50027535-50027557 CCTATGAAAGCAGCCACAGGGAC 0: 4
1: 25
2: 99
3: 207
4: 617
Right 1082255333 11:50027573-50027595 CACAGGGATGGAGCTGCCCAAGG 0: 32
1: 253
2: 494
3: 817
4: 1322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082255325 Original CRISPR GTCCCTGTGGCTGCTTTCAT AGG (reversed) Intergenic
900998312 1:6134624-6134646 GTCCCTGTGGCCGCTGTGATAGG - Intronic
901183348 1:7356694-7356716 TTCCTGGTGGCTGCTTTTATAGG + Intronic
902085382 1:13856228-13856250 GCTCCTGAGGCTGTTTTCATGGG - Intergenic
902089900 1:13894674-13894696 GTCAGTGTTGATGCTTTCATTGG + Intergenic
903146555 1:21376423-21376445 CCCCTTCTGGCTGCTTTCATGGG - Intergenic
903779359 1:25811489-25811511 CTCCATGTTGCTGCTTTCACTGG - Exonic
904283392 1:29437145-29437167 GCCTATGTGGCTGCTCTCATGGG - Intergenic
905965656 1:42093188-42093210 GTCCACATGGCTGCTCTCATGGG + Intergenic
906017118 1:42591798-42591820 GCCCCTGTGGCTGATCTCACTGG - Intronic
906053138 1:42891336-42891358 GTCTCTGTGGCTCCTTTCTATGG + Intergenic
906183462 1:43841126-43841148 GCCCCTGTGGCTGCTCTCATGGG + Intronic
906369061 1:45236766-45236788 GCCTCTGTGGCTGCTCTCACAGG - Intronic
906664288 1:47608219-47608241 GCTCCTGTGACTGCTTTCATGGG + Intergenic
907810604 1:57866016-57866038 ATCCCTGTGGTCTCTTTCATAGG + Intronic
908176991 1:61565703-61565725 GCCCATGTGGCTGCTCTCACAGG + Intergenic
908395267 1:63719705-63719727 GTCCCTGTGGCTGTGTGTATTGG + Intergenic
909060109 1:70869825-70869847 GTCCCTGTGGTTGCTGTCATGGG + Intronic
909083749 1:71147215-71147237 CACTCTTTGGCTGCTTTCATTGG - Intergenic
909133493 1:71768248-71768270 GTCCCTATGGCTGCTCTCATGGG - Intronic
909728929 1:78870907-78870929 GCCCCCATGGCTGCTTTCATAGG + Intergenic
909810278 1:79924457-79924479 CTCACTCTGGCTGCTATCATGGG - Intergenic
909833993 1:80230896-80230918 GCCCCCATGGCTGCTTTCATAGG + Intergenic
909866980 1:80686057-80686079 GCCCCTGTAGCTACTTTCACTGG + Intergenic
910414282 1:86981726-86981748 GCCCTTGTGGCTGCTTTCCTGGG + Intronic
910774477 1:90861633-90861655 CTCCTCCTGGCTGCTTTCATGGG + Intergenic
910812384 1:91251777-91251799 GCCCATGTGGCTGCTTTCATGGG + Intergenic
911009314 1:93262631-93262653 GCCCCTGTGGCTGTTTTCATGGG + Intronic
911235171 1:95404503-95404525 CCTTCTGTGGCTGCTTTCATGGG - Intergenic
911302592 1:96193092-96193114 GTCCCCACTGCTGCTTTCATGGG - Intergenic
911817231 1:102368648-102368670 GCCACTGTGGCTGCTTTCATGGG - Intergenic
911829871 1:102536943-102536965 GCTCCTGTGGCTACTTTCATGGG + Intergenic
912017540 1:105060587-105060609 GCCCCTGTGGCTGCTCTAATGGG + Intergenic
912070258 1:105800736-105800758 GTTCCTGTGGCTGTTTTCATGGG + Intergenic
912192045 1:107352086-107352108 GCCCCTGTGGCTGCTTTCATGGG + Intronic
912206111 1:107511011-107511033 CCCCCTCTGGCTGCTTTCACAGG - Intergenic
912382444 1:109254758-109254780 GTTCCTGTGGCTACTTTGAAGGG - Intronic
912939642 1:114033534-114033556 GTCCCTGTGGGACCTTCCATTGG + Intergenic
913051416 1:115119950-115119972 GGACCTGTGACTGCTCTCATGGG + Intergenic
913316553 1:117558654-117558676 TCCCTTCTGGCTGCTTTCATGGG + Intergenic
914675314 1:149903763-149903785 CTCTGTGTGGCTGCTTTCTTTGG - Exonic
915590912 1:156869768-156869790 TTACCTGTGGCTACTCTCATCGG - Intronic
915719147 1:157971386-157971408 GCCCCTGTGGCTGCTCTCACAGG + Intergenic
915752421 1:158224109-158224131 TCCCTTCTGGCTGCTTTCATGGG - Intergenic
915885718 1:159718691-159718713 GCCCCTGTGGCTGCTTTCACAGG - Intergenic
916604116 1:166324200-166324222 TTCCCTGTGGCTTCTGCCATGGG + Intergenic
916790368 1:168120141-168120163 GCCTCTGTGGCTGCTTTCATGGG - Intronic
916829299 1:168474722-168474744 GCCCCTGCAGCTGCTTTCATGGG - Intergenic
916910604 1:169341625-169341647 GTCCCCATGGCTGCTTTCAAAGG - Intronic
917235575 1:172888501-172888523 GCCTCTATGGCTGCTTTCATGGG + Intergenic
918119936 1:181529548-181529570 TTCCTCCTGGCTGCTTTCATGGG - Intronic
918570023 1:185979154-185979176 TTCCCAGTAGCTCCTTTCATGGG - Intronic
918831525 1:189405078-189405100 CTCCTCCTGGCTGCTTTCATGGG + Intergenic
919006726 1:191908683-191908705 ATCCCTGCACCTGCTTTCATGGG + Intergenic
919179179 1:194059342-194059364 GCCCCTGCAGCTGCTTTCATGGG + Intergenic
919273786 1:195385479-195385501 GTCCCTGTGGCTGCTTTCATGGG - Intergenic
919536689 1:198796703-198796725 GCTCCTGTGGCTGCTTTCACAGG + Intergenic
921013783 1:211168774-211168796 GCCCCTGCAGCTGCTTTCATGGG + Intergenic
922370979 1:224910335-224910357 GCCCCTTTGGCTGGTTTCACAGG + Intronic
923097189 1:230784918-230784940 GTGACTTTGGCTGCTGTCATGGG - Intronic
923139772 1:231151478-231151500 GTCCCTGTGGCTGCTCTCACAGG + Intergenic
923172315 1:231429200-231429222 GCCCCTAGGGCTGCTTTCCTGGG + Intergenic
923208572 1:231782058-231782080 TTTCCTGTAGCTGCTTTCAGTGG + Intronic
923339299 1:232994204-232994226 GTCCCTGCAGCTGTTTTCATGGG - Intronic
1062770444 10:96215-96237 GCCCCTGCAGCTGCTTTCATGGG + Intergenic
1063310268 10:4945579-4945601 GGCCCCATGGCTGCTTTCACTGG - Intronic
1063317031 10:5016569-5016591 GGCCCCATGGCTGCTTTCACTGG + Intronic
1063335581 10:5210311-5210333 TCCCTTCTGGCTGCTTTCATGGG + Intronic
1063767673 10:9160918-9160940 GACCAAGTGGCTGCTTTTATGGG - Intergenic
1064773862 10:18753632-18753654 GTCCCTGTGCTTGATTTCCTTGG + Intergenic
1065895587 10:30160688-30160710 CTCCCTGTGACTGCTTTGAAAGG + Intergenic
1066041047 10:31548285-31548307 GCCCCTGTGGTTGCTCTCACAGG - Intergenic
1066083540 10:31955479-31955501 GTCCCAGTGGCTGCTTCCAAAGG - Intergenic
1067069795 10:43123410-43123432 GTGCGTGTGGCTGCTCTGATGGG + Intronic
1068070214 10:52185433-52185455 CCCCCTGTGGCAGCTGTCATGGG + Intronic
1068147786 10:53093288-53093310 GTCTCTGTGGCTGCTTTTATGGG - Intergenic
1068235846 10:54231638-54231660 GCCCCATTGGCTGATTTCATGGG - Intronic
1068449291 10:57165350-57165372 GCCCCTACAGCTGCTTTCATGGG + Intergenic
1068567169 10:58589002-58589024 GTCCCTGTGACTGCTGTCCAAGG + Intronic
1068580129 10:58730376-58730398 GCCCCTGTGGCTACTGTCATGGG + Intronic
1068717385 10:60203063-60203085 ATCCATGTTGCTGCCTTCATGGG - Exonic
1068848537 10:61708611-61708633 CTCCCTTTGGCTTCTTTCATAGG + Intronic
1069043906 10:63722770-63722792 GTCCCTGTGACTGATTTGCTTGG + Intergenic
1071203887 10:83252374-83252396 GCTCCTGTGGCTGCTCTCACAGG + Intergenic
1073942231 10:108712339-108712361 GCCCCTGAGGCTGCTTTCACAGG + Intergenic
1074226502 10:111489314-111489336 GCCCCTGTGGCTGCTTTCACAGG - Intergenic
1074427893 10:113368316-113368338 ATGCCTGTGGCTGGTTTCATGGG + Intergenic
1075449673 10:122541367-122541389 CTAACTGTGGATGCTTTCATAGG + Intergenic
1077316572 11:1922018-1922040 CTCCCTGTGGCCGCTTTCCCTGG - Intronic
1077523521 11:3050325-3050347 GTGCCTGTGGCTGCTTGGAGTGG - Intronic
1077838321 11:5944939-5944961 GTAACTGTGGCTGCTGTCAGTGG - Intergenic
1078393446 11:10956439-10956461 ACCCCTGTAGCTGCTTTAATGGG - Intergenic
1078650932 11:13191502-13191524 GGCCCTGTGGCTACTTTCACAGG + Intergenic
1079707333 11:23637407-23637429 GCCCCTGCAGCTGCTTTCATAGG + Intergenic
1079759479 11:24310667-24310689 GCCCCTGAGGCTGCTTTCAAGGG - Intergenic
1079769775 11:24444706-24444728 GCCCCTGTGGCTGCTTTCACAGG - Intergenic
1079856352 11:25610266-25610288 CTCCTCCTGGCTGCTTTCATGGG + Intergenic
1079925192 11:26484746-26484768 AACCTTGTGGCTGCTTTCTTGGG - Intronic
1079952629 11:26823668-26823690 GCCCCTGCAGCTGCTTTCACAGG + Intergenic
1079974451 11:27074902-27074924 GCCCCTGTAGCTGCTTTCACAGG + Intronic
1080182572 11:29442664-29442686 GTCCCAGTGGCTGCTCTCACAGG + Intergenic
1081160639 11:39743839-39743861 GCCCCCGTTGCTGCTTTCACAGG - Intergenic
1081270476 11:41077119-41077141 GTCCCCATGGCTGCTTTCATGGG + Intronic
1081358566 11:42144402-42144424 GTCCCTGTGGCTGCTTTCACAGG + Intergenic
1082118974 11:48357614-48357636 GTCCCTGTGGCTGCTTTCATGGG + Intergenic
1082255325 11:50027535-50027557 GTCCCTGTGGCTGCTTTCATAGG - Intergenic
1082827047 11:57587538-57587560 GCCCCTGTGGCTGCTTTCACAGG - Intergenic
1082973057 11:59043675-59043697 GACACCATGGCTGCTTTCATAGG + Intergenic
1083327746 11:61881786-61881808 GTCCCCTTGCCTGCTTTTATAGG + Intronic
1084838803 11:71828056-71828078 GTCCCCATGGCTGCTGTCAAGGG - Intergenic
1085600810 11:77854653-77854675 ACCCCTGTGGCTGCTTTCGTGGG + Intronic
1085767224 11:79293796-79293818 GTCCCTGTGGCTGCAGTCATTGG - Intronic
1085818900 11:79771033-79771055 GCCCCTGTAGCTGCTTTCATGGG - Intergenic
1086799342 11:91152389-91152411 GCCCTTGTAGCTGCTTTCACAGG + Intergenic
1087336641 11:96852163-96852185 GCCCCTGTGGCTGCTTTCATGGG - Intergenic
1087480455 11:98693550-98693572 GCCCCTGTGACTGCTTTCACAGG - Intergenic
1088040474 11:105375433-105375455 CTCCTCCTGGCTGCTTTCATGGG + Intergenic
1088953638 11:114596380-114596402 GGCCCTGTGGCTCCGTCCATGGG + Intergenic
1088960876 11:114663177-114663199 CAACCTGTGGCTGCTGTCATAGG - Intergenic
1089951991 11:122536413-122536435 TCTCCTGTGGCTGCTCTCATGGG - Intergenic
1090105937 11:123853764-123853786 GCCCCTGTGGCTGCTCTCACAGG - Intergenic
1090447453 11:126776190-126776212 CCTCCTGTGGCTGCTTTCAGGGG + Intronic
1090595313 11:128314842-128314864 GCCCCAGTGGCTTCTTTCATTGG + Intergenic
1090854945 11:130602975-130602997 GTACATGTTGCTGCTTTTATAGG - Intergenic
1091146241 11:133282721-133282743 GACCCTGTGGCTGCTCTCACAGG - Intronic
1091316543 11:134617886-134617908 GCCCCCATGGCTGCTCTCATTGG - Intergenic
1091552944 12:1550562-1550584 GCCCCCATGGCTGCTTTCATGGG - Intronic
1092275659 12:7059143-7059165 GTGCCTGTGTCTTCTTTCTTGGG + Intronic
1092724852 12:11475119-11475141 GCCCCTGTGGCTGCTCCCAGGGG - Intronic
1092944257 12:13438604-13438626 GCACCTGCAGCTGCTTTCATGGG + Intergenic
1093306579 12:17527953-17527975 GCCCATGTGACTGCTTTCACAGG - Intergenic
1093591208 12:20904502-20904524 GTCCCCATGGCTGCTTTCATGGG + Intronic
1093910954 12:24746964-24746986 CTCCATGTGCCTGCTTTCTTTGG - Intergenic
1093988974 12:25569115-25569137 GCCCCTGCAGCTGCCTTCATGGG - Intronic
1094251677 12:28369462-28369484 AGCCCTGTGGCTGCTTCCACAGG + Intronic
1094253909 12:28399884-28399906 CTCCTCCTGGCTGCTTTCATGGG + Intronic
1095838785 12:46669395-46669417 GCCCCAGTGGCTGCTCTCACAGG + Intergenic
1095889608 12:47223295-47223317 TTCCCTGTTGCTCCTTTCAGTGG - Intronic
1095929743 12:47613547-47613569 GGCCATGTAGCTGCTCTCATGGG - Intergenic
1095978745 12:47958063-47958085 GCCCCTTTGGCTGCTTTCATGGG - Intergenic
1096886837 12:54726806-54726828 GCCCCCTTGGCTGCTTTCATGGG + Intergenic
1097302710 12:58035534-58035556 GCCCCTGTAGCTGCTTTCACAGG + Intergenic
1097343581 12:58466941-58466963 GCCCCTGTGGATGCATTCACAGG + Intergenic
1097401586 12:59134527-59134549 GCCCTTGTGGCTGCTTTCTCAGG + Intergenic
1097492734 12:60290933-60290955 GCCCCTGTGACTGCTTTCATGGG - Intergenic
1097501500 12:60409694-60409716 GTCACCATGGCTGCTTTCATGGG + Intergenic
1097513141 12:60568270-60568292 GCCCCCATGGCTGCTCTCATTGG - Intergenic
1098319886 12:69232449-69232471 GCCCCTGTGGCTGCTTTCATGGG - Intergenic
1098432915 12:70440212-70440234 GTCCAAGTGTCTGCTTTCTTTGG + Intergenic
1098559060 12:71851814-71851836 GCCCCTGTGGCTGCTCTCAAGGG + Intronic
1098771543 12:74559425-74559447 GTCCCTACAGCTGCTTTCATGGG + Intergenic
1098836422 12:75429168-75429190 GGCCCTGTGGCTGCTTTCACAGG - Intronic
1099229249 12:80003425-80003447 GCCCCTGTGGCTGCTTTCACAGG + Intergenic
1099466997 12:83000565-83000587 CTCCTCTTGGCTGCTTTCATGGG + Intronic
1099487807 12:83249691-83249713 GCCCCTGTGGCTGTTTTCATGGG - Intergenic
1099568096 12:84278514-84278536 ACCCCTTTGGCTGCTTTCACTGG + Intergenic
1099724829 12:86412326-86412348 GCCCCTATGGCTGCTCTCAAGGG - Intronic
1099858752 12:88203666-88203688 GCCCCTGAGGCTGCTCTCATGGG + Intergenic
1099890805 12:88586406-88586428 GCCCCTGTGCATGCTCTCATGGG + Intergenic
1099897289 12:88664549-88664571 GTTCCTGGGGCTGCTTTGAAGGG + Intergenic
1099987792 12:89688068-89688090 GTGCCTTTGGGTGCTTACATAGG - Intronic
1100286392 12:93170931-93170953 TTCCCTTTGGCTGCTTACAAAGG - Intergenic
1100376148 12:94017900-94017922 GCCCCTGTGGCTGCTTTCACAGG - Intergenic
1100597974 12:96087959-96087981 GCTCCTGTGGCTGCTTTCAAGGG - Intergenic
1101846647 12:108368277-108368299 GTCCCTGGGGCTGCTTTGGAAGG - Intergenic
1102523236 12:113492461-113492483 CTCCTCCTGGCTGCTTTCATGGG - Intergenic
1103223642 12:119267685-119267707 ACCCCCATGGCTGCTTTCATGGG - Intergenic
1103358058 12:120336380-120336402 GCCCCCATGGCTGCTTTCAGGGG + Intergenic
1103579302 12:121902571-121902593 GTGCCTGTGGCTGCTTGTCTGGG + Intronic
1105256513 13:18746912-18746934 GCCCCCATGGCTGCTCTCATGGG - Intergenic
1105256934 13:18749977-18749999 GCCCCCATGGCTGCTCTCATGGG - Intergenic
1105257378 13:18753087-18753109 GCCCCTGCAGCTGCTTTCATGGG - Intergenic
1105258713 13:18762920-18762942 GCACCTGTAGCTGCTCTCATGGG - Intergenic
1105259614 13:18769352-18769374 GCCCCCATGGCTGCTCTCATGGG - Intergenic
1105260052 13:18772451-18772473 GCCCCTGCAGCTCCTTTCATGGG - Intergenic
1105261382 13:18782223-18782245 GCACCTGTAGCTGCTCTCATGGG - Intergenic
1105262290 13:18788669-18788691 GCCCCCATGGCTGCTCTCATGGG - Intergenic
1105734643 13:23255194-23255216 GTCCCAGTGGCTTCTCTCATGGG - Intronic
1106130618 13:26936374-26936396 TCCCCTGTGGCTGCTTTCATGGG - Intergenic
1106614775 13:31316278-31316300 GCCCCTGTGGCTGCTTTCACAGG - Intronic
1106662155 13:31810912-31810934 GCCCATGTGGCTGCTTTCACAGG - Intergenic
1106714465 13:32373690-32373712 GCCCCTGCAGCTGCTTTCATGGG + Intronic
1106907644 13:34425406-34425428 GTAGCTGTGGCTGGTCTCATTGG - Intergenic
1106934215 13:34700477-34700499 TTCTCTGTTGCTGCTTTCCTCGG + Intergenic
1107330758 13:39296873-39296895 GTTCCTGTGGCTGCTTTCACGGG - Intergenic
1107403597 13:40092711-40092733 ATCCCCGTGGCTGCTTCCCTGGG + Intergenic
1107984037 13:45759586-45759608 GTCCCTGAGGATGTTTTCAAAGG - Intergenic
1108321168 13:49292006-49292028 GTCCCTGTTGGTGATTACATTGG - Exonic
1108582919 13:51842152-51842174 ATCCCTGTACCTGCCTTCATAGG - Intergenic
1108612463 13:52097371-52097393 GCCCCTGCGGCTGCTCTCACAGG - Intronic
1108771018 13:53700351-53700373 GCCCCTGTGGCTGCTTTCACAGG - Intergenic
1108893636 13:55294983-55295005 GCCCCTGAGGCTGCTCTCATTGG - Intergenic
1109476116 13:62882282-62882304 TCCCTTGAGGCTGCTTTCATGGG + Intergenic
1109717442 13:66234698-66234720 GCACCTGTGGCTGTTTTCATGGG - Intergenic
1109906294 13:68846289-68846311 GCCCCTGCAGCTGCTTTCACAGG - Intergenic
1109910617 13:68905881-68905903 GTTCATGTAGCTGCTCTCATGGG - Intergenic
1110189545 13:72715069-72715091 GCCCCCATGGCTGCTTTCGTGGG - Intronic
1110595488 13:77316750-77316772 GTCCAGGTGGCTGACTTCATGGG + Intronic
1111036122 13:82676999-82677021 CCCCTTCTGGCTGCTTTCATGGG + Intergenic
1111050947 13:82882808-82882830 GCCCCTCTGTCTGCTCTCATGGG - Intergenic
1111051144 13:82884272-82884294 ATCCCTGTGGCTGATCTCATGGG + Intergenic
1111085530 13:83371760-83371782 GCCCCCACGGCTGCTTTCATGGG + Intergenic
1111144846 13:84166718-84166740 GCCCCTGCAGCTGCTTTCATGGG + Intergenic
1111207849 13:85035585-85035607 GTCACCATGGCTGCTCTCATAGG - Intergenic
1111217449 13:85163069-85163091 ATCCCCGTGGCTGCTGTCATGGG + Intergenic
1111318108 13:86586882-86586904 GGCCCCATGGCTGCTTTCACAGG - Intergenic
1111419892 13:87998721-87998743 GTCCCCATAGCTGCTGTCATGGG - Intergenic
1111463370 13:88575775-88575797 GCCCCTGGTGCTGCTTTCATGGG + Intergenic
1111641912 13:90980013-90980035 GCCCCCGTAGCTGCTTTCATGGG + Intergenic
1111778687 13:92694379-92694401 GCCCCTGCAGCTGCTTTCACAGG - Intronic
1112252182 13:97792584-97792606 GCCCCTGTAGCTGCTGTCACAGG + Intergenic
1112696269 13:101952547-101952569 TTTCCTGTGGCTGTTTCCATAGG + Intronic
1112742902 13:102495317-102495339 GCCCCTGTAGCTGCTTTCATGGG + Intergenic
1114433037 14:22678780-22678802 GCCCCTGCAGATGCTTTCATCGG - Intergenic
1115916503 14:38321142-38321164 GTCCCTACAGCTGCTCTCATTGG + Intergenic
1115929804 14:38478322-38478344 CTCCCTCCAGCTGCTTTCATGGG - Intergenic
1115944471 14:38644073-38644095 GTCCCTGCAGCTGCTTTCACAGG - Intergenic
1116119657 14:40706043-40706065 GCCCCTGTGGTTGCTTTCATGGG + Intergenic
1116811197 14:49541461-49541483 ACCTCTGTGGCTGCTTTCATGGG - Intergenic
1116917299 14:50537582-50537604 CTCCCTCTGGCTGCTTTCATGGG - Intronic
1116931303 14:50693978-50694000 TCCCTTCTGGCTGCTTTCATGGG + Intergenic
1117209507 14:53481193-53481215 GACCCTGGAGCTGCCTTCATGGG + Intergenic
1118119927 14:62829171-62829193 GCCCCCATAGCTGCTTTCATGGG + Intronic
1118169630 14:63375250-63375272 GTCCCAGTGCCTGTTTTCAAAGG + Exonic
1119181554 14:72608719-72608741 GTCACCGTGACAGCTTTCATGGG - Intergenic
1119397453 14:74337655-74337677 GTACCTGTGCCTGTTTTCTTGGG + Intronic
1120101610 14:80451024-80451046 GCCCCTTTGGCTGCTTTCATGGG - Intergenic
1120230607 14:81836844-81836866 GCCCCTGTGGCTGCTTTCACAGG - Intergenic
1120257864 14:82142305-82142327 GTCACCATGGCTGCTTTCAAAGG - Intergenic
1120270706 14:82309876-82309898 GCCCCCCTGGCTGCTTTCACTGG - Intergenic
1120575374 14:86174864-86174886 TCCCTTCTGGCTGCTTTCATGGG - Intergenic
1120755536 14:88240749-88240771 GTCCCAGTGGCTGCTGTTGTTGG + Exonic
1121369261 14:93341942-93341964 GGCCCCGTGACTGCTTTCACAGG + Intronic
1121914186 14:97820948-97820970 GCCCCTGCAGCTGCTTTCATGGG - Intergenic
1121962442 14:98273919-98273941 TTCTCTATGGCTGCTTTCCTGGG + Intergenic
1122442366 14:101740880-101740902 GCCCCCATGGCTGCTTTCACAGG + Intergenic
1122831953 14:104402552-104402574 GCCCCCTTGGCTGCTTTTATGGG - Intergenic
1123128179 14:105964705-105964727 GACCCCATGGCTGCTCTCATGGG - Intergenic
1123140586 14:106073508-106073530 CTCCCCATAGCTGCTTTCATAGG - Intergenic
1123189169 14:106551422-106551444 GTCCCCATGACTGCTTTGATAGG - Intergenic
1202834252 14_GL000009v2_random:65952-65974 GCCCCCATGGCTGCTCTCATGGG + Intergenic
1202835520 14_GL000009v2_random:75191-75213 GCCCCCATGGCTGCTCTCATGGG + Intergenic
1123937122 15:25199406-25199428 GTCCCTCTGGATGCATGCATGGG + Intergenic
1123954816 15:25324381-25324403 ATCCCAGTGGCTGGTGTCATCGG + Intergenic
1124509024 15:30306568-30306590 GCCTCTGTGGCTGCTTTCATGGG + Intergenic
1124734533 15:32232094-32232116 GCCTCTGTGGCTGCTTTCATGGG - Intergenic
1124798499 15:32806350-32806372 GTCACTATGGCTGTTCTCATGGG - Intronic
1125066040 15:35487120-35487142 GCTCCTGCAGCTGCTTTCATGGG + Intronic
1125225311 15:37389360-37389382 GCCCCTGCAGCTGCTTTCACAGG + Intergenic
1126490611 15:49231879-49231901 GCCCCTGAGGCTGCTTTCATGGG + Intronic
1127026719 15:54815103-54815125 GCCCCTGTAGCTGGTTTCATGGG - Intergenic
1127377138 15:58395103-58395125 CTCCCTGTGGGTGATTTCAGAGG - Intronic
1127571930 15:60251873-60251895 GTGCTTGTGCCTGTTTTCATAGG - Intergenic
1128335901 15:66785653-66785675 GGCCCTGTGGCTGCCTTCTCGGG + Intergenic
1129812729 15:78523949-78523971 GCCCCTGTGGCTGCTCTCAAGGG + Intronic
1131314247 15:91318837-91318859 GTCCATGTGGATACTTTCTTTGG + Intergenic
1131372106 15:91891208-91891230 GTACCTGTGGCTGATTTGAATGG - Intronic
1131439196 15:92445955-92445977 TTTCTTGTGGCTGCTATCATGGG - Intronic
1131726779 15:95235025-95235047 ATCTCAGTGGCTGTTTTCATAGG + Intergenic
1132209021 15:100006922-100006944 GTGCCAGTGGCTGCTTCCTTTGG - Intronic
1132608781 16:804812-804834 GTCCCTGGGGCGGCTTTCCTAGG + Intergenic
1133043033 16:3070705-3070727 GCCCCCGCAGCTGCTTTCATGGG + Intronic
1133045118 16:3083640-3083662 GCCCCCGCAGCTGCTTTCATGGG + Intergenic
1135014864 16:18916844-18916866 ATCCCTGAGGCTCCTTTCATTGG - Intronic
1136331962 16:29585815-29585837 ATCCCTGAGGCTCCTTTCATTGG - Intergenic
1136446597 16:30325560-30325582 ATCCCTGAGGCTCCTTTCATTGG - Intergenic
1137638611 16:50009062-50009084 GCCCCCATGGCTGCTTTCATGGG - Intergenic
1138402079 16:56754614-56754636 GCCCTCTTGGCTGCTTTCATGGG + Intronic
1138770066 16:59652569-59652591 GCCCATGTGGCTGCTCTCACAGG + Intergenic
1138800066 16:60016413-60016435 GCCCTTGTGGCTGCTCTCACAGG + Intergenic
1141313037 16:82933934-82933956 CTCCTCCTGGCTGCTTTCATGGG + Intronic
1143599432 17:7934445-7934467 GTCCCTCTGGCTGCCTGCAGGGG + Exonic
1144324746 17:14168315-14168337 GCCCTCATGGCTGCTTTCATGGG + Intronic
1144351690 17:14403004-14403026 GCCCCTTTGGCTGTTTTCACAGG - Intergenic
1144368771 17:14570202-14570224 ACCCCTGTGGCTGCTCTTATGGG + Intergenic
1144533676 17:16065506-16065528 GACCCAGTGGCTGCTCTCTTGGG + Exonic
1144605134 17:16658218-16658240 GCCCCTTTGGCTGTTTTTATGGG + Intergenic
1146279444 17:31535829-31535851 GTTTCTGCGGCTGCTTTCAGGGG - Exonic
1146391832 17:32429998-32430020 GACCCTGCAGGTGCTTTCATGGG - Intergenic
1146648621 17:34592226-34592248 ATGCCTGTGACTGCTTTCCTGGG - Intronic
1147195919 17:38766638-38766660 GCCCCTGTGGCTGTTCTCAGTGG - Exonic
1149079154 17:52632949-52632971 GTCCCTGTGGCTGCTCTCACAGG - Intergenic
1150354443 17:64471072-64471094 TTCCCTGAGGCTGCTTTCTAGGG + Intergenic
1150622483 17:66818572-66818594 GCCCATGTGGCTACTTCCATGGG - Intergenic
1150978798 17:70119228-70119250 GTCCCTGAGACTGCTGTCACAGG + Intronic
1151415674 17:73961091-73961113 GTCCCCATGGCTGCTGTCATGGG - Intergenic
1151902085 17:77022958-77022980 GTCCCCATGGCTGCTCTCACAGG - Intergenic
1153347988 18:4049308-4049330 GGCTCTGTGACTGCATTCATGGG + Intronic
1153506400 18:5803763-5803785 GCCCCCTTGGCTACTTTCATGGG - Intergenic
1154424200 18:14259472-14259494 GCCCCCATGGCTGCTCTCATGGG + Intergenic
1154425972 18:14272350-14272372 GCCCCTGCAGCTGCTTTCATGGG + Intergenic
1154426869 18:14278674-14278696 GCCCCCATGGCTGCTCTCATGGG + Intergenic
1154429601 18:14298208-14298230 GCCCCCATGGCTGCTCTCATGGG + Intergenic
1154430046 18:14301471-14301493 GCACCTGTAGCTGCTCTCATGGG + Intergenic
1154431870 18:14314554-14314576 GCCCCCATGGCTGCTCTCATGGG + Intergenic
1154432333 18:14317811-14317833 GCACCTGTAGCTGCTCTCATGGG + Intergenic
1154433662 18:14327590-14327612 GCCCCTGCAGCTGCTTTCATGGG + Intergenic
1154434528 18:14333766-14333788 GCCCCCATGGCTGCTCTCATGGG + Intergenic
1155318507 18:24595512-24595534 TTCACAGTGGCTGCTTTCAGAGG - Intergenic
1155707784 18:28837930-28837952 GTCCCCACAGCTGCTTTCATGGG + Intergenic
1155745864 18:29355946-29355968 GCCTCTGTGGCTGTTTTCACAGG - Intergenic
1156281810 18:35646444-35646466 TTGCCTGGGGCTGCTTTCAAGGG + Intronic
1157077304 18:44479760-44479782 GCCCCTGTGGCTGCTTTTGTGGG - Intergenic
1158101563 18:53835155-53835177 GTCCTCATGGCTGCATTCATAGG - Intergenic
1158129783 18:54139870-54139892 GCCCCTGTGGCTGCTTTCATGGG - Intergenic
1158904728 18:62001043-62001065 GCCCATGTGGCTGTTCTCATGGG + Intergenic
1159319593 18:66830146-66830168 GCCACTGTGGCTGCTCTCATAGG + Intergenic
1161782335 19:6301502-6301524 GTCCCTCTGGCTGGCTTCATGGG - Intergenic
1162350340 19:10145098-10145120 GGCCCTGTGGCGCCTTACATTGG - Intronic
1162736863 19:12751802-12751824 GTCCCTGTGGGTCCTTGCACCGG + Exonic
1163037542 19:14579555-14579577 CTCCCTGTTGCTGCTCCCATGGG + Intergenic
1166140827 19:40804230-40804252 TTCCCTGTGGCTGCCTTCCAGGG + Intronic
1166629184 19:44390240-44390262 TCCCTTCTGGCTGCTTTCATGGG - Intronic
1166638080 19:44469560-44469582 TCCCTTCTGGCTGCTTTCATGGG + Intergenic
1167769561 19:51506137-51506159 GGCCACGTGGCTGCTCTCATAGG - Intergenic
1168100113 19:54137154-54137176 GGCCCTGTGGCTGTTTTGATTGG + Intergenic
1168655322 19:58123332-58123354 GCCCCTGTGGCTGCTTTCACAGG + Intergenic
925323762 2:2999147-2999169 GTCGCTGGGGCTGCTGTGATTGG - Intergenic
925357202 2:3250205-3250227 GTCCCCATGGCTGCCTGCATGGG - Intronic
925384239 2:3450885-3450907 GTCCCTTTGGCAGCTGTCACGGG - Intronic
925494808 2:4435178-4435200 ACACCTGTGGCTGTTTTCATAGG + Intergenic
925497622 2:4469749-4469771 CTCCCTGTGGGTGCCTGCATAGG - Intergenic
925737955 2:6980618-6980640 GCCGCTGCAGCTGCTTTCATAGG + Intronic
925794902 2:7530892-7530914 GCCCCTGTGGCTGCTTTCACAGG + Intergenic
926067818 2:9858374-9858396 GCCCCCAAGGCTGCTTTCATGGG + Intronic
926465033 2:13177207-13177229 GTCCTCCTGGCTGCTTTCACAGG + Intergenic
926493628 2:13556924-13556946 GTTCCTGTGGCTGCCTGCCTAGG + Intergenic
926598302 2:14814343-14814365 GCCCCCATGGCTGCTTTCACAGG - Intergenic
926769061 2:16351797-16351819 ACCCCTGCAGCTGCTTTCATGGG - Intergenic
926926536 2:17993588-17993610 CTCTCCCTGGCTGCTTTCATGGG - Intronic
927380781 2:22476903-22476925 TCCCCTCTGGCTGCTTTCATGGG - Intergenic
927611812 2:24548859-24548881 TTCCTCATGGCTGCTTTCATGGG + Intronic
927922283 2:26982299-26982321 GCCCCTGTGGCTGCTTTGCATGG - Intronic
928468901 2:31553861-31553883 CTCCCTGTGGCTGCTGTAACAGG + Intronic
928474928 2:31616396-31616418 CTCCTCCTGGCTGCTTTCATGGG - Intergenic
928797576 2:35040628-35040650 GCCCTCGTGGCTGCTTTCATGGG - Intergenic
929119122 2:38469357-38469379 GTCCCTGGGCCTGCCTGCATTGG + Intergenic
929565300 2:42980019-42980041 GTCCATGTGGGTGCGTTCAGGGG + Intergenic
930404900 2:50942456-50942478 GATCCTGTGGCTGCTTTCACAGG - Intronic
930456680 2:51614904-51614926 CTTCTTCTGGCTGCTTTCATGGG + Intergenic
930503654 2:52255453-52255475 TCCCCGCTGGCTGCTTTCATGGG + Intergenic
930560053 2:52949783-52949805 GCCCTCCTGGCTGCTTTCATGGG + Intergenic
930812967 2:55561533-55561555 GCCCCCATGGCTGCTTTCATGGG - Intronic
930952114 2:57155842-57155864 GGCCCTGTGGCTGCTCTCACAGG + Intergenic
931800874 2:65756628-65756650 GCCCCTATGGCTGCTCTCATTGG + Intergenic
931845386 2:66198820-66198842 GTCCCTTTGGGTACTTTCAACGG - Intergenic
931989773 2:67778617-67778639 GTACCTGTGGTTGTTTTGATCGG - Intergenic
932956540 2:76357476-76357498 GCCCATGTGGCTGCTTTCATGGG - Intergenic
933482016 2:82869814-82869836 GCCCCCATGGCTGCTCTCATGGG + Intergenic
933938481 2:87226044-87226066 GTCAGTGTGGCATCTTTCATGGG + Intergenic
934037660 2:88101925-88101947 GTCCCTGTCTGTGCTTTGATTGG + Intronic
934106866 2:88703140-88703162 TTCCTCCTGGCTGCTTTCATGGG + Intronic
934491561 2:94764722-94764744 GCCCCCATGGCTGCTTTCATGGG - Intergenic
934491993 2:94767809-94767831 GCCCCCATGGCTGCTCTCATGGG - Intergenic
934493002 2:94774937-94774959 GCCCCCATGGCTGCTTTCATGGG - Intergenic
934493402 2:94777936-94777958 GCCCCCATGGCTGCTCTCATGGG - Intergenic
935324992 2:101927794-101927816 TCCCCTATGGCTGCTTTCATGGG - Intergenic
935798779 2:106671512-106671534 GTCCCTGCAGCTGCTCTCAAGGG - Intergenic
936014465 2:108947285-108947307 GCTCCTGTAACTGCTTTCATGGG + Intronic
936081573 2:109436031-109436053 CTCCCTGTGGCTGGTATCACTGG - Intronic
936096778 2:109536253-109536275 TCCCTCGTGGCTGCTTTCATGGG - Intergenic
936354656 2:111739730-111739752 GTCAGTGTGGCATCTTTCATGGG - Intergenic
936470184 2:112791747-112791769 GCCCATGTGGCTGATCTCATGGG - Intergenic
936499501 2:113054893-113054915 CTCCTCCTGGCTGCTTTCATGGG + Intergenic
936730275 2:115374406-115374428 AGCCCTTTGGCTGCTTTCATAGG + Intronic
936777771 2:115994653-115994675 GCCCCTGTGGCTGCTCTCTCAGG - Intergenic
936831781 2:116655759-116655781 CCCCATCTGGCTGCTTTCATGGG + Intergenic
936837168 2:116722692-116722714 GCCCCTGTGGCTGCTCTCATGGG + Intergenic
936874516 2:117172359-117172381 GTCCCTGTGTCTGCTCTCATGGG - Intergenic
937491346 2:122371430-122371452 TCTCCTGTGGCTGCTTTCATGGG + Intergenic
937518683 2:122685209-122685231 ACCCCCCTGGCTGCTTTCATAGG + Intergenic
937751086 2:125476923-125476945 CTGCTTCTGGCTGCTTTCATGGG - Intergenic
937827967 2:126388516-126388538 GCCCCCGTGGCTGCTTTCACAGG - Intergenic
938225774 2:129614875-129614897 GTCCTTCTGGCTACTTGCATGGG - Intergenic
938279555 2:130054278-130054300 GCCCCCATGGCTGCTCTCATGGG - Intergenic
938279858 2:130056185-130056207 GCCCCCGTGGCTGCTCTCATGGG - Intergenic
938330502 2:130444988-130445010 GCCCCCATGGCTGCTCTCATGGG - Intergenic
938330810 2:130446900-130446922 GCCCCCGTGGCTGCTCTCATGGG - Intergenic
938359135 2:130674603-130674625 GCCCCCGTGGCTGCTCTCATGGG + Intergenic
938359443 2:130676515-130676537 GCCCCCATGGCTGCTCTCATGGG + Intergenic
938435536 2:131281252-131281274 GCCCCCGTGGCTGCTCTCATGGG + Intronic
938435841 2:131283164-131283186 GCCCCCATGGCTGCTCTCATGGG + Intronic
939278990 2:140038480-140038502 GCCCCCATGGCTGCTTTCATGGG + Intergenic
940402836 2:153267211-153267233 GCCCCTGAAGCTGCTTTCACAGG + Intergenic
940426868 2:153540596-153540618 GGCCCGGGGGCTGCTTTCATTGG - Intergenic
940733851 2:157426880-157426902 GTCCTTGAATCTGCTTTCATTGG - Intronic
940974801 2:159930821-159930843 GTCTCTGAGCCTGCTTCCATAGG + Intergenic
941261856 2:163307259-163307281 GCCCCTGGAGCTGCTCTCATGGG - Intergenic
942319560 2:174724630-174724652 CCCCTTCTGGCTGCTTTCATGGG + Intergenic
942991568 2:182208630-182208652 GCCCCCATGGCTGCTTTCACTGG - Intronic
943086563 2:183318652-183318674 GTCCCTGGTGCTGCTTTAAGGGG + Intergenic
943143996 2:184018664-184018686 GCCCCTTTGGCTGCTTTCACGGG - Intergenic
943207493 2:184919331-184919353 GTCTCTGTCGCTGCTGGCATTGG + Intronic
943315745 2:186385764-186385786 GTCCCTGTGGCTGCTTTCCCAGG + Intergenic
943478137 2:188384938-188384960 GCCCTCCTGGCTGCTTTCATGGG + Intronic
943832377 2:192478875-192478897 GCCCCTGCAGCTGCCTTCATGGG - Intergenic
944372105 2:198996627-198996649 GTCTCTGTGACTGCTCTCATGGG + Intergenic
944477728 2:200124686-200124708 CTCCTCCTGGCTGCTTTCATGGG + Intergenic
944943032 2:204651524-204651546 GCCCCTTTTGCTGCTTTCATGGG + Intronic
945109512 2:206349080-206349102 GCCCCTGTGGCTGTTTTCATGGG + Intergenic
945120754 2:206454891-206454913 GCCTCTGTGGCTGCTTTCATGGG + Intronic
945984217 2:216341081-216341103 GTTCCAGTGACTGCTTTCCTGGG - Intronic
946317091 2:218923572-218923594 GCCCCCATAGCTGCTTTCATGGG + Intergenic
946501027 2:220247253-220247275 TTGTGTGTGGCTGCTTTCATGGG - Intergenic
946515048 2:220402645-220402667 GCCCCTGTGGCTGCTTTCATGGG - Intergenic
946543939 2:220716049-220716071 GCCCCTTCGGCTGCTTTCACAGG + Intergenic
946937480 2:224736843-224736865 GCTCTTGTGGCTGCTTTCATGGG - Intergenic
946995337 2:225384515-225384537 GCCCCTGTGGCTGCTTTCATGGG - Intergenic
947183299 2:227431933-227431955 GCCCCCATGGCTGCTCTCATGGG + Intergenic
948292369 2:236835316-236835338 GTCCCTGCAGCTGCTTTCATGGG + Intergenic
948852556 2:240715523-240715545 GTCTCTGTGGCTGCCTGCCTGGG - Exonic
1169165007 20:3415455-3415477 GGCCCTGAGGCTTCTCTCATGGG + Intergenic
1169950616 20:11039363-11039385 GTCCATGTGGCTGCTTATTTAGG - Intergenic
1170113532 20:12831432-12831454 GTCCATGAGCCTTCTTTCATTGG + Intergenic
1170122073 20:12922672-12922694 GCCCCTGTGGCTGCTCTCATGGG - Intergenic
1170479922 20:16755410-16755432 GCCCCCATGGATGCTTTCATGGG + Intronic
1171490720 20:25515149-25515171 GGCCCTGTGGTTGCTTTCATGGG - Intronic
1171883268 20:30633181-30633203 GCCCCCATGGCTGCTGTCATGGG - Intergenic
1171968439 20:31548385-31548407 GTCCCCGAGGCTGCTTTTGTGGG - Intronic
1172088987 20:32413722-32413744 GTGCATGTGGCTGTTTTCCTCGG + Intronic
1172488425 20:35314600-35314622 GTCCCTGTGGCTTCCCTCAGAGG + Intronic
1172834701 20:37865548-37865570 GTCTCTGTGGCTGCCTGCATGGG + Intronic
1173060233 20:39653545-39653567 TTCCCTGTCCCTGCTTTCCTTGG + Intergenic
1173399370 20:42710822-42710844 GCCCATGTGGCTGCTCTCATGGG - Intronic
1174115734 20:48225166-48225188 GTCCCTGTGGCTGTGTGCTTGGG - Intergenic
1176051598 20:63122587-63122609 GTCCCTGTGGTCACATTCATGGG + Intergenic
1176070141 20:63222058-63222080 GTCCCTGTGGCTCCATGCATGGG + Intergenic
1176842510 21:13851940-13851962 GCCCCCATGGCTGCTCTCATGGG - Intergenic
1176842922 21:13855028-13855050 GCCCCCATGGCTGCTCTCATGGG - Intergenic
1176843370 21:13858154-13858176 GCCCCTGCAGATGCTTTCATGGG - Intergenic
1176844702 21:13867940-13867962 GCACCTGTAGCTGCTCTCATGGG - Intergenic
1176845621 21:13874375-13874397 GCCCCCATGGCTGCTCTCATGGG - Intergenic
1176847445 21:13887504-13887526 GCACCTGTAGCTGCTCTCATGGG - Intergenic
1176847897 21:13890765-13890787 GCCCCCATGGCTGCTCTCATGGG - Intergenic
1176848354 21:13893929-13893951 GCCCCCATGGCTGCTCTCATGGG - Intergenic
1176849271 21:13900524-13900546 GGCCCCATGGCTGCTCTCATGGG - Intergenic
1177169531 21:17640268-17640290 GCACCTGCAGCTGCTTTCATGGG + Intergenic
1177206481 21:18016756-18016778 GATCCCTTGGCTGCTTTCATGGG - Intronic
1177328801 21:19629310-19629332 GCCCCCATGGCTGCTTTCACAGG - Intergenic
1177477691 21:21645087-21645109 CTCCTCCTGGCTGCTTTCATGGG - Intergenic
1178178532 21:30132664-30132686 ACCCCTGTGGCTGCTTTCTCAGG + Intergenic
1178218215 21:30625176-30625198 GTCCTGGTAGCTGCTCTCATAGG + Intergenic
1178765887 21:35450642-35450664 GCCCCTGTGGCTGCTCTCACAGG + Intronic
1179216839 21:39374804-39374826 GCCCCCGCTGCTGCTTTCATTGG + Intergenic
1179921585 21:44510410-44510432 GTCCCAGTGGTTGCTGTCACGGG - Intronic
1180180156 21:46115166-46115188 ATCCCTGTGGCAGCTTCCAGTGG - Intronic
1180393141 22:12303406-12303428 CTCCTTCTGGCTGCTTTCACAGG - Intergenic
1180790358 22:18572412-18572434 GTCCCTGAGGTTGGTTTCTTGGG - Intergenic
1181231380 22:21422903-21422925 GTCCCTGAGGTTGGTTTCTTGGG + Intronic
1181247271 22:21511965-21511987 GTCCCTGAGGTTGGTTTCTTGGG - Intergenic
1181358377 22:22316279-22316301 GCCCCTGTGGCTACTCTCATAGG + Intergenic
1182816861 22:33171960-33171982 GCCCCTGTGGATGCTTTCACAGG - Intronic
1182866813 22:33611285-33611307 GCCCCTGCAGCTGCTCTCATGGG - Intronic
1182948904 22:34352811-34352833 GTCTCTGTGGATGCCTTCATGGG - Intergenic
1183205147 22:36413728-36413750 GCCCCTGTAGATCCTTTCATGGG - Intergenic
1183208615 22:36436008-36436030 GTCACAGTGGCTGCTTTTCTGGG - Intergenic
1183275901 22:36897590-36897612 AGCCCTGTGGCTGCTCTCTTGGG - Intergenic
1184318489 22:43719147-43719169 CGCCCTGTGGCTGCTCTCACAGG + Intronic
1184403676 22:44287905-44287927 GCCCCCGTGGCTGCTGCCATGGG - Intronic
949612338 3:5715545-5715567 GCCCCTGTGGCTGCTCTCATGGG - Intergenic
949770309 3:7570609-7570631 TTCCTTCTGGCTGCTTTCATGGG + Intronic
950099416 3:10347853-10347875 CTCCCTGTGGCTGCTTCCTATGG + Intronic
950607519 3:14096091-14096113 ATCCCTGGGGCTGCTCTCACAGG + Intergenic
950627576 3:14259340-14259362 GTCCCTGGGTCTCCTTTCAAAGG + Intergenic
951100678 3:18684537-18684559 GACCCCTTGGCTGCTTTCATGGG - Intergenic
951317614 3:21205592-21205614 CCCCCCTTGGCTGCTTTCATGGG - Intergenic
951452157 3:22852074-22852096 CCCCTCGTGGCTGCTTTCATGGG + Intergenic
951853367 3:27168139-27168161 TTCCCTGTGACTTCTCTCATTGG + Intronic
952114643 3:30164013-30164035 GTTCCAGAGGCTGGTTTCATTGG + Intergenic
952374858 3:32757721-32757743 GTCCCTGAGTCTTCCTTCATGGG + Intronic
952734992 3:36680670-36680692 CCCCCCATGGCTGCTTTCATGGG + Intergenic
953377982 3:42444826-42444848 GCCCCTGTGGCTGCTTTTGCGGG - Intergenic
953385792 3:42505003-42505025 GTCCCTGTGCCTGCTGTCCGGGG - Intronic
953835391 3:46338826-46338848 GCCCCCATGGCTGCTTTCACAGG + Intergenic
953898441 3:46823028-46823050 GCCCCCGCAGCTGCTTTCATGGG + Intergenic
955395458 3:58554089-58554111 GCCCCTGCGGGTGCTTTCATGGG + Intergenic
955833193 3:63026385-63026407 CCCCCTTTGGCTGCTTTCGTGGG + Intergenic
956336969 3:68175383-68175405 TTCCTCCTGGCTGCTTTCATGGG - Intronic
957322875 3:78654592-78654614 GTCCATCTGGTTGCTTGCATAGG - Intronic
957412853 3:79862725-79862747 GCCCCTGCAGCTGCTTTCATGGG - Intergenic
957524176 3:81358474-81358496 GCCCCTGTGGCTGCTTTCATGGG - Intergenic
957630468 3:82710950-82710972 CTCCCCCTGGCTGCTTTCATGGG + Intergenic
957746265 3:84347276-84347298 GCCTCTGCAGCTGCTTTCATGGG + Intergenic
957768624 3:84658832-84658854 GCCTCTGTGGCTGCTTTAAAGGG - Intergenic
957868060 3:86050349-86050371 GTGCCTGTGGCTGCTCTTATGGG + Intronic
958175534 3:89991385-89991407 GCTCCCATGGCTGCTTTCATGGG - Intergenic
958256602 3:91332366-91332388 GTCCCTGAGGCTGCTTTCAGGGG - Intergenic
958474971 3:94569109-94569131 GTCCTTGGGGCTGCTTTCACAGG - Intergenic
958583961 3:96061867-96061889 GCCCCTGCAGCTGCTTTCATGGG - Intergenic
958684773 3:97378560-97378582 TCCCTTCTGGCTGCTTTCATGGG - Intronic
958692506 3:97485551-97485573 GCCCTTGTGGCAGCTTTCAGAGG - Intronic
958710274 3:97709194-97709216 GCCCCATTGGCTGCTTTCACAGG - Intronic
958836910 3:99156917-99156939 GACCCTGAAGCTGCTTTCTTGGG - Intergenic
958860296 3:99437453-99437475 CTCCTCCTGGCTGCTTTCATGGG - Intergenic
958927976 3:100179649-100179671 GTCCCCATGGTTGCTTTCACAGG + Intergenic
959171314 3:102847744-102847766 GCCCCTGCAGCTGCTTTCACTGG + Intergenic
959900981 3:111661763-111661785 GTCCTCTTGGCTGCTTTCACAGG + Intronic
959935337 3:112022949-112022971 GCCCCTGTGGCTGCTCTCATGGG - Intergenic
959973467 3:112432305-112432327 CTCCCTCTGGCTGCCTTCACAGG - Intergenic
960133782 3:114085651-114085673 GTCACTGTGACTTCTTTCTTAGG + Exonic
960214894 3:115020374-115020396 GTCACTGAAGCTACTTTCATGGG - Intronic
960384820 3:117010168-117010190 TTCCCTGTGGCACCTTTCAGTGG + Intronic
960494187 3:118355223-118355245 GCCCCTGAGACTGCTTTCACAGG - Intergenic
960581509 3:119282979-119283001 GTCCCCATAGCTGCTTTTATAGG - Intergenic
960724686 3:120658502-120658524 GCACCTGCGGCTGCTCTCATGGG + Intronic
960837969 3:121926795-121926817 GCCCCTGTGGCTGCTCTCACAGG - Intronic
960849524 3:122037306-122037328 GCCCCTTTGGCTGCTTTCATGGG - Intergenic
961029654 3:123590672-123590694 GTCCCAAAGGCTGCTTTCATGGG + Intergenic
961067581 3:123889613-123889635 GCCCCTGTGGCTACTTTCACAGG + Intergenic
961621307 3:128227031-128227053 GTCCCTCTGGTTGCTTGCTTGGG + Intronic
962162440 3:133013406-133013428 AACCCTGTGGCTGCTCTCATGGG - Intergenic
963471558 3:145748144-145748166 GCCCCTGTGGCTGCTTTCATAGG + Intergenic
963572566 3:147016042-147016064 GACTATGTGGCTGATTTCATGGG - Intergenic
963683475 3:148410018-148410040 GACCCTGTGGCTACTTTCACAGG + Intergenic
963777267 3:149452001-149452023 GCCCCTGTGGCTGCTTTCATGGG + Intergenic
963816597 3:149838191-149838213 TTCCTCTTGGCTGCTTTCATGGG + Intronic
964853423 3:161119363-161119385 GCCCCTCCAGCTGCTTTCATGGG - Intronic
965051141 3:163648876-163648898 GCCCCTGTGGCTGTTCTCATGGG + Intergenic
965404814 3:168255625-168255647 GCCCCTGTGGCTGCTTTCATGGG + Intergenic
966241292 3:177757657-177757679 GCCCCTGAGGCTGCTCTCAAGGG + Intergenic
966500738 3:180635719-180635741 GCCCCTGTGGCTGCCTTCACAGG + Intronic
966972866 3:185061277-185061299 ATCCCTGTGGCTGCTTTTGTGGG - Intergenic
967208404 3:187145136-187145158 GCCCCCATGGCTGCTTTCACGGG + Intronic
967564701 3:190959801-190959823 CTCCTCCTGGCTGCTTTCATGGG - Intergenic
967592975 3:191299819-191299841 GCCCCCGTGGCTGCTCTCAAGGG - Intronic
967719368 3:192799134-192799156 GTCCCTGTGGTATCTTTCAAAGG - Exonic
967806011 3:193715202-193715224 GCCCCTGAGGCTGCTCTCAAAGG - Intergenic
967883607 3:194318411-194318433 AGCCCTGTGGCTGCTCTCATGGG + Intergenic
967908363 3:194520421-194520443 TCCCTTCTGGCTGCTTTCATGGG - Intergenic
968350513 3:198048485-198048507 GCCCCCATGGCTGCTCTCATGGG - Intergenic
968558239 4:1261320-1261342 GTCACTCTGGCTGCTCTCAGGGG + Intergenic
969103671 4:4788988-4789010 GACCCTGAGGCTGCTTTCACAGG - Intergenic
969108027 4:4822651-4822673 GCCCCCAAGGCTGCTTTCATGGG - Intergenic
969780224 4:9395540-9395562 GTCCCCATGGCTGCTGTCAAGGG - Intergenic
970062539 4:12051043-12051065 GTCCCTGTGGCTGCTCTAATTGG - Intergenic
970100418 4:12515048-12515070 GCCCCTGCAGCTGCTTTCATAGG - Intergenic
970721789 4:18997030-18997052 TCCCTTATGGCTGCTTTCATGGG + Intergenic
971026602 4:22594891-22594913 GTCCCTGCAGCTGGATTCATGGG + Intergenic
971856696 4:32053692-32053714 GTCCCTGCAGCTGCTTTCATTGG + Intergenic
971889076 4:32494089-32494111 GTCCCTGAGCCTGCATTCCTAGG + Intergenic
972102017 4:35431852-35431874 GCCCCCATGGCTGCTTTCATGGG - Intergenic
972406106 4:38748010-38748032 GCCCCTGTGGCTGCTTTCATGGG - Intergenic
972829847 4:42802452-42802474 GCCCCTGTGGCTGCTTTCAAGGG + Intergenic
972844363 4:42970178-42970200 GTCCCAGAAGCTGCTTTCATGGG + Intronic
972957995 4:44416001-44416023 GCCCATGTGGCTGCTCTCATGGG - Intronic
973214982 4:47658356-47658378 GTCCCCATGGCTACTTTCACAGG + Intronic
973366926 4:49215498-49215520 GCCCCCATGGCTGCTCTCATGGG - Intergenic
973393694 4:49576907-49576929 GCCCCCATGGCTGCTCTCATGGG + Intergenic
973542306 4:51946694-51946716 GCCCCAGTGGCTGCTTTCATGGG - Intergenic
973732136 4:53832949-53832971 GCTCTTTTGGCTGCTTTCATAGG - Intronic
973831924 4:54770074-54770096 GTGCCTGTTGCTTCTTTCACTGG - Intergenic
974409396 4:61519978-61520000 GTTGTTATGGCTGCTTTCATTGG - Intronic
974492759 4:62588415-62588437 GTACCTGTAGCTGCTTTCACAGG + Intergenic
974606291 4:64156479-64156501 GCCCATGTGGCTGCTTTCATGGG + Intergenic
974608408 4:64183657-64183679 GCTCCTGCGGCTCCTTTCATGGG + Intergenic
974624131 4:64400061-64400083 GTCCCTATGGCTGCTCTAACAGG - Intronic
974867409 4:67597568-67597590 TCCCCTGCGGCTGCTTTCATGGG - Intronic
974923412 4:68269964-68269986 GCTCCTGTGCCTGCTTTCACAGG + Intergenic
974969637 4:68807909-68807931 CTCCCGTTGGCTGCTTTCATGGG - Intergenic
974973380 4:68858965-68858987 GCCCCCATGGATGCTTTCATGGG - Intergenic
975000564 4:69220289-69220311 CTCCTCTTGGCTGCTTTCATGGG + Intergenic
975627046 4:76360471-76360493 GCCCCCATGGCTGCTTTCATGGG - Intronic
976678173 4:87725944-87725966 CTCCCCCTGGCTGCTTTCACGGG - Intergenic
976706759 4:88027219-88027241 GCCCCTGCAGCTGCTTTCACAGG - Intronic
976842245 4:89445291-89445313 GCTCCTGTGGCTGCTTTCATAGG + Intergenic
976853469 4:89576116-89576138 GCCCCAGCAGCTGCTTTCATGGG - Intergenic
977396611 4:96479003-96479025 GCCCCTGCAGCTGCTTTCAGGGG - Intergenic
977676409 4:99753048-99753070 GTCTCAGTGGCTGCTTGAATGGG + Intergenic
977707318 4:100086392-100086414 GGCCATGTGGCTGCTCTCACAGG + Intergenic
977783469 4:101006132-101006154 GCCTCTGTGTCTGCTTTCACAGG - Intergenic
977832296 4:101608468-101608490 CCCCTTCTGGCTGCTTTCATGGG - Intronic
978044282 4:104107144-104107166 GCCCCCTTGGCTGCTTTTATGGG - Intergenic
978474084 4:109106232-109106254 GTGCTTGTGGCTGGTGTCATAGG - Intronic
978809797 4:112837578-112837600 GCCCCTGAGGCTGCTTTCATGGG - Intronic
978844658 4:113258328-113258350 ATACATGTGGCTGCCTTCATGGG + Exonic
978983730 4:114983307-114983329 GCCCCCATGGCTGCTTTCACAGG - Intronic
979049323 4:115910104-115910126 GTCCCTGTGGCTGCTTTCTTGGG + Intergenic
979060844 4:116058939-116058961 GCCCCTGCAGCTGCTTTCACAGG + Intergenic
979180617 4:117721840-117721862 GCCCTCTTGGCTGCTTTCATGGG - Intergenic
979362689 4:119783367-119783389 GGCCCTGCGGCTACTCTCATGGG + Intergenic
979414336 4:120417689-120417711 CACCTTGTGGCTGCTTTCATGGG - Intergenic
979645217 4:123060150-123060172 CTCCCTCTGGCTGCTTTCACAGG + Intronic
979775179 4:124581504-124581526 GCCCCTATGGCTGTTTTCACAGG + Intergenic
979805085 4:124961092-124961114 GCCCCTGTGGCTGCTTTCATGGG + Intergenic
979885715 4:126025207-126025229 GCCCCCGTGACTGCTTTCACAGG - Intergenic
979922961 4:126524463-126524485 CTCCTCCTGGCTGCTTTCATGGG + Intergenic
979951287 4:126897029-126897051 GCCCCTGTGGCTATTTTCACAGG + Intergenic
980202817 4:129677574-129677596 TCCCTCGTGGCTGCTTTCATGGG - Intergenic
980247608 4:130267481-130267503 GTTCCTGTGGCTGCTTTCACAGG - Intergenic
980264055 4:130492702-130492724 GACTCTGTGGCTTCTTTCATGGG - Intergenic
980383588 4:132058572-132058594 GCCCCTGCAGCTGCTTTCATGGG - Intergenic
980406986 4:132366330-132366352 GTCCCTGCAGCTACTTTCAGGGG + Intergenic
981176815 4:141691760-141691782 GTCCCTTTAGCTGCTTTCATGGG + Intronic
981356827 4:143798919-143798941 GCCCCTGTGGCTGCTTTCACAGG + Intergenic
981368355 4:143929516-143929538 GCCCCTGTGGCTGCTTTCACAGG + Intergenic
981378152 4:144039801-144039823 GCCCCTGTGGCTGCTTTCACAGG + Intergenic
981411939 4:144442401-144442423 GCCCCTGAAGCTGCTTTCACAGG + Intergenic
981637471 4:146897480-146897502 GGCCCTGTGGTTGCAGTCATAGG - Intronic
982210149 4:153028258-153028280 GCCCCTGTGGGTGCTCTCATGGG + Intergenic
982310047 4:153975067-153975089 GTCTCCATGGCTGCTTTCATGGG - Intergenic
982627501 4:157785999-157786021 GCCCCTGCAGCTGCTTTCACAGG + Intergenic
982923457 4:161305063-161305085 TCCCTTCTGGCTGCTTTCATGGG - Intergenic
983132799 4:164043028-164043050 GCCCCTGTGGCTGCTTTCATGGG + Intronic
984117114 4:175695360-175695382 GTCCTTGTGGCTGTTCTCATGGG - Intronic
984355369 4:178652308-178652330 AGCCCTGTGGTTGCTTTCATGGG - Intergenic
984516955 4:180752830-180752852 CTCCCTCCAGCTGCTTTCATGGG + Intergenic
984699768 4:182811373-182811395 GCCCCTCTGGCTGCTTTCATGGG + Intergenic
985076828 4:186224376-186224398 GCCCCTACGGCTGCCTTCATGGG - Intronic
985183950 4:187296168-187296190 TGCCCTCTGGCTGCTTTCATGGG + Intergenic
985386422 4:189452638-189452660 GCCCCCATGGCTGCTCTCATGGG - Intergenic
1202764427 4_GL000008v2_random:138015-138037 GCCCCCATGGCTGCTCTCATGGG - Intergenic
1202765764 4_GL000008v2_random:147598-147620 GCCCCCATGGCTGCTCTCATGGG - Intergenic
985607758 5:867502-867524 GCCTCTGTGGCTGCTTTCCCTGG - Intronic
986099773 5:4596384-4596406 GTCCCTGTGGCTGCTTTCACAGG - Intergenic
986351732 5:6886482-6886504 CTCCCTGTGGCTTCTTGCTTGGG - Intergenic
986557718 5:9027745-9027767 GCCCCTGCAGCTGCTTTCACTGG - Intergenic
986582391 5:9279100-9279122 CGCCCCTTGGCTGCTTTCATGGG - Intronic
986837168 5:11651592-11651614 GCTTCTGTGGCTGCTTTCATGGG - Intronic
986893749 5:12340210-12340232 GTCCCTCTGTCTTCTCTCATGGG + Intergenic
987003833 5:13688934-13688956 GCCCCTGTGGCTGCTTTCACGGG - Intergenic
987169663 5:15240808-15240830 GCCCCCATGGCTGCTTTCATGGG - Intergenic
987460079 5:18198428-18198450 GTCCCTGTGGCTGCTCTCACAGG - Intergenic
987541479 5:19261400-19261422 CTCCTCCTGGCTGCTTTCATGGG - Intergenic
987680829 5:21133807-21133829 TCCCTTCTGGCTGCTTTCATGGG - Intergenic
987909355 5:24122087-24122109 GTCCCCATGCCTGCTTTCAGAGG + Intronic
987967301 5:24893247-24893269 GCCCCTACAGCTGCTTTCATGGG + Intergenic
988150013 5:27364974-27364996 CTCCTTCTGGCTACTTTCATGGG - Intergenic
988359134 5:30212645-30212667 CCCCCTCTGGCTGCTGTCATGGG - Intergenic
988386634 5:30574057-30574079 GCCCCTGCAGCTGCTTTCATGGG - Intergenic
988448039 5:31310384-31310406 GCCCCCGAGGCTGCTTTCATGGG + Intronic
988579747 5:32458631-32458653 GCCCCTGTGGCTGCTTTCATGGG + Intergenic
988621979 5:32832381-32832403 GTCCCAGTGGCTGCTATTTTAGG + Intergenic
988647341 5:33108761-33108783 GCCCCTGTGGCTGCTCTCATTGG - Intergenic
988671347 5:33385279-33385301 GCCCCTGCAGCTGCTCTCATGGG + Intergenic
988863430 5:35308493-35308515 GTCCCCAAGGCTGCCTTCATCGG + Intergenic
988907072 5:35800953-35800975 GTTCCTGTAACTGCATTCATGGG + Intronic
988976881 5:36524648-36524670 GTCCATGTGGCTGCGCTTATTGG + Intergenic
989218256 5:38927147-38927169 CTCCTTCTGGCTGCTTTCATGGG + Intronic
989254366 5:39350755-39350777 GACCCTGCAGCTGCTTTCATGGG + Intronic
989308202 5:39981585-39981607 GTCACCATGGCTGCTTTCACAGG - Intergenic
989746884 5:44839685-44839707 GCCCCTGCAGCTGCTTTCATGGG - Intergenic
989817189 5:45750747-45750769 GTCCCCGCGGCTGGTTTCACAGG + Intergenic
990429210 5:55717944-55717966 TTCCTCCTGGCTGCTTTCATGGG - Intronic
990744971 5:58950277-58950299 GTTGCTGGGGTTGCTTTCATTGG - Intergenic
990844524 5:60122146-60122168 CTCCCACTGGCTGCTTTCATGGG + Intronic
990883701 5:60568620-60568642 GCCCCCATGGCTGCTTTCACAGG + Intergenic
991116810 5:62964133-62964155 TCCCTTCTGGCTGCTTTCATGGG + Intergenic
991122586 5:63032992-63033014 GACCCTGTGGCTGCTTTCATGGG - Intergenic
991204879 5:64038947-64038969 GCCCCTGTGGCTGCTCTCTTGGG - Intergenic
991355700 5:65767003-65767025 ACCCCTGTAGCTGCTTTCACAGG + Intronic
991535967 5:67669592-67669614 GCCTCTGTAGCTGCTCTCATGGG - Intergenic
992504829 5:77376509-77376531 GTCCCAGTCCCTGCATTCATAGG - Intronic
992625393 5:78632121-78632143 GTCCCTGTGGCTGTTGTGAGTGG - Intronic
993084556 5:83348098-83348120 GCCCCCATGGCTGCTTTCATAGG + Intronic
993253092 5:85553419-85553441 GCCCCTGTGGCTGCTTTCATGGG + Intergenic
993320711 5:86465484-86465506 GTGCCTGGGGCTGCATGCATTGG - Intergenic
993581016 5:89661131-89661153 GCCCTTGTGGCTTCTCTCATGGG - Intergenic
993743267 5:91565079-91565101 TCCCTTCTGGCTGCTTTCATGGG + Intergenic
993752818 5:91691774-91691796 GCCCCCATGGCTGCTTTCACGGG + Intergenic
994283746 5:97938549-97938571 GCCCCCTTGGCTGCTTTCCTGGG - Intergenic
994592409 5:101789496-101789518 CCCCCCATGGCTGCTTTCATGGG - Intergenic
994631616 5:102295128-102295150 TTCCCTGTGCCTTCTTTCAAGGG + Intronic
994655918 5:102593105-102593127 TCCCTTTTGGCTGCTTTCATGGG + Intergenic
994878851 5:105460692-105460714 GCCCCTTTGGCTGCTTTCATGGG + Intergenic
994900383 5:105762463-105762485 TTCCTCCTGGCTGCTTTCATGGG + Intergenic
995391033 5:111640315-111640337 GCCCTTCTGGCTGCTTTCACAGG - Intergenic
995559397 5:113364447-113364469 GCCCCTGTGGCTACTTTCATGGG + Intronic
995702875 5:114955526-114955548 CCCCTTCTGGCTGCTTTCATGGG - Intergenic
995856977 5:116603436-116603458 TTGTCTGGGGCTGCTTTCATGGG - Intergenic
995904202 5:117103986-117104008 GTCTGTGTGGCTGCTTTCCATGG - Intergenic
996046707 5:118882330-118882352 GTCCCTACGGCTGCTTTCATGGG + Intronic
996071538 5:119137057-119137079 GTGCCTGTGGCTGCTTTCACAGG - Intronic
996222445 5:120950157-120950179 TCCCTTCTGGCTGCTTTCATGGG - Intergenic
996600122 5:125253342-125253364 CTCCTCCTGGCTGCTTTCATGGG + Intergenic
996829125 5:127720446-127720468 GCCACCATGGCTGCTTTCATGGG + Intergenic
997046995 5:130330574-130330596 GCCTCCATGGCTGCTTTCATGGG - Intergenic
997100055 5:130958656-130958678 GCCCCTGTGGCTGCTTTCATGGG - Intergenic
997159676 5:131594644-131594666 GCCCCTGTGGCTACCTTCATGGG - Intronic
997575825 5:134976491-134976513 CTCCCTGTGTCTGCTCTCATGGG + Intronic
997584870 5:135038258-135038280 CTCCCAGCGGCTGCTTTCATGGG + Intronic
998294292 5:140952166-140952188 GTTCCTGCAGCTGCTCTCATGGG + Intronic
998487748 5:142517663-142517685 GCCCCTCAAGCTGCTTTCATAGG - Intergenic
998581810 5:143384735-143384757 GACCCTGCAGCTGCTTTCACAGG + Intronic
999346045 5:150820452-150820474 TTCCTTCAGGCTGCTTTCATGGG + Intergenic
999398228 5:151244392-151244414 GCCCCTGTGGCTGCGCTCCTTGG - Intronic
999452145 5:151686469-151686491 GTCCCTGTGGCAGCTGTGATGGG + Intronic
999711148 5:154319704-154319726 TTCCCTGTGGCTCCTTTCTGAGG + Intronic
999842986 5:155449319-155449341 GCCCCTGTAGCTGCTATCACAGG + Intergenic
1000039181 5:157472454-157472476 TTCTCTGTGGCTGCTGTCAAGGG + Exonic
1000103165 5:158035938-158035960 GTCCCTGTGTCTGTTCTTATGGG - Intergenic
1000262346 5:159600048-159600070 GTCCATGTGGCTGCTTTCACAGG + Intergenic
1000492078 5:161926267-161926289 CTCCCTCTGGCTCCTTTCACAGG - Intergenic
1000548805 5:162633885-162633907 GCCCCTGCAGCTGCTTTCATGGG + Intergenic
1000575020 5:162966475-162966497 GCCCCCAGGGCTGCTTTCATTGG + Intergenic
1000575457 5:162970127-162970149 GCCCCTGTGGCTTCTTTCACAGG - Intergenic
1001100626 5:168810887-168810909 GTCCCTGCGGCTGCTTGCATGGG + Intronic
1001879330 5:175229640-175229662 GGCACTGTGGCTGTATTCATGGG + Intergenic
1002859768 6:1070487-1070509 CTCCCTGTTGCTGCTTCCCTGGG + Intergenic
1002892976 6:1352806-1352828 CTCCCTCCAGCTGCTTTCATGGG + Intergenic
1003259734 6:4506449-4506471 GCCCTTGCAGCTGCTTTCATGGG + Intergenic
1003484367 6:6563057-6563079 GCCACCGTGGCTGCTTTCATGGG + Intergenic
1003569887 6:7248781-7248803 CTCCCTGTGGCTGCAGTCCTTGG - Exonic
1004076811 6:12351316-12351338 GCCCCCTTGGCTGCTTTCATGGG + Intergenic
1005808448 6:29496944-29496966 ATCTCTGTGTGTGCTTTCATTGG + Intergenic
1008189643 6:48439003-48439025 CCCCCTGTGGTTGCTTTCACTGG - Intergenic
1008869637 6:56257658-56257680 TTTTCTGTGGCTGCTTTCACAGG - Intronic
1008871025 6:56272183-56272205 GCCCCTGTGACTGCTTTCTTGGG - Intronic
1008998739 6:57688794-57688816 GTCCCTGAGGCTGCTTTCAGGGG + Intergenic
1009187223 6:60588173-60588195 GTCCCTGAGGCTGCTTTCAGGGG + Intergenic
1009377498 6:62990661-62990683 CCCCTTCTGGCTGCTTTCATGGG + Intergenic
1009377891 6:62994219-62994241 GACCCAATGGCTGCTTTAATGGG + Intergenic
1009608718 6:65908289-65908311 GTCCTTGTGGCTGCTACCACTGG - Intergenic
1009791153 6:68403391-68403413 GCCCCTGTGGCTACTTTCATGGG + Intergenic
1010360520 6:74987610-74987632 CCCCCAGTGGCTGCTTTCATGGG - Intergenic
1010366585 6:75058768-75058790 GCCCCCATGGCTGCTTTCATGGG + Intergenic
1010458145 6:76082621-76082643 CCCCTTCTGGCTGCTTTCATGGG + Intergenic
1010517353 6:76789690-76789712 GTCTCTGTGGCTGTTCTCATGGG + Intergenic
1010525308 6:76894075-76894097 CTCCTTCTGGCTGCTTACATGGG + Intergenic
1010611075 6:77954187-77954209 GACACTGTGGCTGCTTTCATGGG - Intergenic
1010659721 6:78556061-78556083 GCCCCCATGGCTGCTTTCACAGG + Intergenic
1011152476 6:84289785-84289807 GTCCTTTTGGTTCCTTTCATGGG + Intergenic
1011504606 6:88028112-88028134 GCCCCCATGGCTGCTTTCACAGG + Intergenic
1011733545 6:90290965-90290987 GTCCTTGTGTCAGCTTTCATTGG - Intronic
1011792762 6:90915897-90915919 CTCCTCCTGGCTGCTTTCATGGG - Intergenic
1012254484 6:97016276-97016298 GTCCCCCTCTCTGCTTTCATGGG - Intronic
1012342342 6:98142851-98142873 GCCCCTTTGACTGCTTTCACGGG + Intergenic
1013549148 6:111190323-111190345 CCCCTTCTGGCTGCTTTCATGGG + Intronic
1013716356 6:112967679-112967701 GTCCCTGCAGCTGCTTTCATGGG + Intergenic
1014075564 6:117230779-117230801 GCCCCCATGGCTGCTCTCATGGG + Intergenic
1014247427 6:119082734-119082756 GCCCCCATGGCTGCTTTCATGGG + Intronic
1014374731 6:120658944-120658966 GCCCCCATGGCTGCTTTCATGGG + Intergenic
1014861282 6:126470662-126470684 GCCCCCGTGGCTGCTTTTATGGG - Intergenic
1014933829 6:127364159-127364181 GCCCCTGTGGCTGTTTTCACAGG - Intergenic
1015001778 6:128226058-128226080 GTCCGTGTGGCTCCTCTTATTGG - Intronic
1015178666 6:130338548-130338570 GCCCCTGAGGCTGCTGTCATGGG - Intronic
1015252628 6:131142793-131142815 GCCCCTGTGGCTGCTCTCACAGG - Intronic
1015347228 6:132174637-132174659 GCCCCTGTGGCTGTCTTCACAGG + Intergenic
1015652555 6:135479310-135479332 GCCCCTGCAGCTGCTTTCACTGG - Intronic
1015777745 6:136831869-136831891 GTCCTTATGGCTGCTTTCACTGG + Intronic
1016094592 6:140020195-140020217 AGCCCCGGGGCTGCTTTCATAGG + Intergenic
1016126373 6:140408740-140408762 ACCCCTGTGGCTGCTTTCACAGG - Intergenic
1016128378 6:140434393-140434415 GCCCCTGCGGCTGCTTTCATTGG - Intergenic
1016261341 6:142174199-142174221 GCCCCTGTGGCTGCTCCCACAGG - Intronic
1016264282 6:142213371-142213393 GCCCCCTTGGCTGCTTTCACAGG + Intronic
1016284917 6:142462478-142462500 CTCCTCCTGGCTGCTTTCATGGG + Intergenic
1016632595 6:146249819-146249841 CACCCCCTGGCTGCTTTCATGGG - Intronic
1016785941 6:148010909-148010931 GACCCTGTGGCTACTTTCATAGG - Intergenic
1017654386 6:156613709-156613731 GCCCCTGCAGCTGCTTTCAGGGG + Intergenic
1017801952 6:157904831-157904853 GTCCCTCTGGCTGCTGTAATAGG + Intronic
1017898929 6:158704241-158704263 CTGTCTGTGGCTGCTGTCATAGG + Intronic
1017966364 6:159270495-159270517 GTCCCTGTGACTGTGGTCATGGG + Intronic
1018407741 6:163505423-163505445 GTCCCCTCGGCTGCTTTCATGGG - Intronic
1018548315 6:164962926-164962948 GTCCCTGTGGCTGCTATCACAGG - Intergenic
1018592609 6:165443451-165443473 GCCCCTGTGGCTGCTTTCATGGG + Intronic
1019107236 6:169678204-169678226 GCCCTTGTGGCTGCTTTCACTGG - Intronic
1019726758 7:2607001-2607023 GGCTCTGTGTTTGCTTTCATTGG + Intronic
1020450451 7:8315577-8315599 GTGCCTGTAGCTGCTGTCATGGG + Intergenic
1020668186 7:11073517-11073539 GCCCCCTTGGCTGCTCTCATGGG + Intronic
1020809485 7:12833802-12833824 GCTCCCATGGCTGCTTTCATGGG + Intergenic
1021617747 7:22520243-22520265 GCCCCTCCAGCTGCTTTCATGGG - Intronic
1021807422 7:24371166-24371188 GTCTCTGTTGCTGCTTTCATGGG + Intergenic
1022316077 7:29246827-29246849 CTCTCTGGGGCTGCTTTTATAGG + Intronic
1022784816 7:33627573-33627595 GCCCCCTTGGCTGCTTTCACGGG - Intergenic
1022927336 7:35069719-35069741 GCCCCTCCAGCTGCTTTCATGGG - Intergenic
1023235404 7:38081279-38081301 GTCCCTTTGGCTGCTTTCATGGG + Intergenic
1023275718 7:38516755-38516777 GTTCCTGAGACTGCTTTCATCGG - Intronic
1023543221 7:41288802-41288824 GTCCCCAAGGCTGCTGTCATGGG - Intergenic
1023690342 7:42779594-42779616 GAACCTGTAGCTACTTTCATGGG - Intergenic
1024754937 7:52518540-52518562 GTACCCGTGGCTACTCTCATGGG + Intergenic
1024860583 7:53835352-53835374 GACCCCATGGCTGCTCTCATGGG - Intergenic
1025121085 7:56303935-56303957 GTCCCAGTGCCTGTTTTCAAAGG + Intergenic
1025144329 7:56491740-56491762 GTCCCTGGGGCTGCTGTCCTCGG - Intergenic
1026292268 7:69018421-69018443 GCCCCTGTGGCTGCTGTCGTGGG + Intergenic
1027341092 7:77209448-77209470 GCCCCTGCACCTGCTTTCATGGG + Intronic
1027395229 7:77746971-77746993 GCCCCTGTGGCTGCTCTCAAGGG + Intronic
1027528549 7:79301289-79301311 GTCCCCATGGCTGCTCTCTTAGG - Intronic
1027545529 7:79523302-79523324 TTAACTGTGGCTACTTTCATAGG - Intergenic
1027560182 7:79719384-79719406 GCCTCTGTGGCTGCTTTCACGGG + Intergenic
1027789494 7:82620954-82620976 GGTCATGTGGCTGCTCTCATGGG - Intergenic
1027831433 7:83182615-83182637 GGCCCCTTGGCTGCTTTTATGGG + Intergenic
1028374932 7:90135865-90135887 GCCCCTCCAGCTGCTTTCATGGG + Intergenic
1029495502 7:100894039-100894061 GGCCCTGTCTCTGCTTTCCTGGG - Exonic
1030527596 7:110672854-110672876 CCCCTTCTGGCTGCTTTCATGGG + Intronic
1030559054 7:111062887-111062909 CTCCTCCTGGCTGCTTTCATGGG + Intronic
1031035648 7:116785178-116785200 AGCCCCATGGCTGCTTTCATCGG + Intronic
1031087143 7:117314024-117314046 GTCCCTGGGGGGGCTTTAATAGG - Intronic
1031429565 7:121650708-121650730 ATCCCTGTGACAGCTCTCATGGG - Intergenic
1031806771 7:126316793-126316815 GCCCCTACAGCTGCTTTCATGGG + Intergenic
1031807662 7:126327546-126327568 GCCCTTGTGGCTGTTTTCTTGGG - Intergenic
1032256549 7:130301918-130301940 GTTCATGAGGCTGATTTCATGGG - Intronic
1032330557 7:130975201-130975223 GCCCCTGTGGCTGCTCTCAAGGG - Intergenic
1032346246 7:131119368-131119390 TCCCCTGCAGCTGCTTTCATGGG + Intronic
1032366820 7:131307482-131307504 GCCCCTGCAGCTGCTTTCATGGG - Intronic
1033482987 7:141760272-141760294 GCCCCTGTGTCCACTTTCATGGG + Intronic
1033730288 7:144171556-144171578 CTCCCTCCGGCTGCATTCATGGG - Intergenic
1033837702 7:145335571-145335593 GCCCTACTGGCTGCTTTCATGGG + Intergenic
1033910753 7:146260444-146260466 GCCCCCATGGCTACTTTCATGGG - Intronic
1034510651 7:151531992-151532014 CTCCTCCTGGCTGCTTTCATGGG + Intergenic
1036277648 8:7369520-7369542 GTCCCCATGGCTGCTGTCAAGGG - Intronic
1036779053 8:11633361-11633383 GGCCCTGGGGCTGCTTTCCAGGG - Intergenic
1037415869 8:18649217-18649239 GTCCCTGCGGTTGCTCTCATGGG - Intronic
1038200697 8:25410171-25410193 GTTCCTCTGGCTGCCTTCATAGG - Exonic
1039742198 8:40393178-40393200 GGCCCTGTGGCTGCCTTGAAGGG + Intergenic
1039910096 8:41819667-41819689 GTGACTGTGCCTGCTTTCAGGGG - Intronic
1040091229 8:43400934-43400956 GCCCCTGTGGCTGCTTTCTTGGG + Intergenic
1040102718 8:43519588-43519610 GCCCCCGTGGCTGCTCTCATGGG + Intergenic
1041145423 8:54870977-54870999 GCCCCTCTGCCTGATTTCATGGG - Intergenic
1041491546 8:58438406-58438428 GGCCCTGTGGCTTCTCTCATGGG - Intronic
1041549077 8:59079854-59079876 GCCCCTGAGGCTGCTCTCACAGG - Intronic
1041632035 8:60099339-60099361 GCCCCCATGGCTGCTTTCAGGGG + Intergenic
1041902447 8:62996901-62996923 GCCTCTGCGGCTGCTTTCACAGG + Intronic
1041940507 8:63382122-63382144 GCCCCTTTGGCTGCTTTCACTGG - Intergenic
1042923193 8:73940255-73940277 TGCCTTCTGGCTGCTTTCATGGG - Intronic
1043222726 8:77687254-77687276 GCCCCTGTTGCTGCTCTCATGGG - Intergenic
1043241178 8:77937749-77937771 TCCCATGTGGCTGCTTTCATCGG + Intergenic
1044040177 8:87357354-87357376 GCCCACGTGGCTTCTTTCATGGG - Intronic
1044295199 8:90519171-90519193 GCCCCCTTGGCTGCTTTCAAGGG - Intergenic
1044326953 8:90869432-90869454 GCCCCTGTAGCTGCTTTCATGGG - Intronic
1044655326 8:94542241-94542263 CTGCCTGTGGCTTCTTTCTTGGG + Intronic
1045079041 8:98604376-98604398 GCCCCTGAGGCTGCTCTCATGGG + Intronic
1045214118 8:100129921-100129943 TTCCTCCTGGCTGCTTTCATGGG + Intronic
1045258113 8:100546761-100546783 GTCCCTGTGGCTGCTTTCATGGG - Intronic
1046257629 8:111721892-111721914 GCCCCCATGGCTGCTTTCACAGG + Intergenic
1046492251 8:114968067-114968089 CTCCCTCTGGCTATTTTCATGGG - Intergenic
1046656392 8:116899529-116899551 TCCCTTCTGGCTGCTTTCATGGG - Intergenic
1047404850 8:124576954-124576976 TTCCCTGTGGCTGCATTCAGGGG - Intronic
1047688296 8:127323459-127323481 GCCCGTGTTGCTGCTTTCATGGG - Intergenic
1047923335 8:129657488-129657510 GCCCCTGCAGCTGCTTTCATAGG + Intergenic
1048038957 8:130706715-130706737 GCCCTTGTGGCTGCTTTCATTGG + Intergenic
1048096418 8:131300307-131300329 GCCCCTGTGGCTGCTCTCACAGG + Intergenic
1048160179 8:132012506-132012528 GGCCCTGTGGCAGCTGTCACTGG + Exonic
1048213488 8:132476405-132476427 ACTCCTGTGGCTGCTTCCATGGG - Intronic
1048474112 8:134727773-134727795 TTCCCTTTGGCTGCTTTCATGGG - Intergenic
1048758682 8:137767391-137767413 CCCCCTTTGGCTGCTTTCATGGG - Intergenic
1049101535 8:140582969-140582991 GTCTGTGTGGCTGCTTCCAGAGG + Intronic
1050255326 9:3787371-3787393 CTCCTCCTGGCTGCTTTCATGGG + Intergenic
1050402508 9:5271116-5271138 GCCCCTGAGGCTGCTTTCATGGG - Intergenic
1051194327 9:14546906-14546928 GCCCCCACGGCTGCTTTCATTGG + Intergenic
1052208260 9:25869846-25869868 GCCCCTGTGGCTTCTGTCACAGG + Intergenic
1052314020 9:27097629-27097651 GCCTCTGTGGCTGCTCTCACAGG - Intergenic
1052518137 9:29510004-29510026 CTCCTTCTGGCTGCTTTCACAGG + Intergenic
1052878031 9:33581891-33581913 AGCCCCGTGGCTGCTCTCATGGG + Intergenic
1052879770 9:33594271-33594293 GCCCCTGTGGCTGCTCTCATGGG + Intergenic
1053060714 9:35029080-35029102 GTCCATGTGGCTGTTCTCATGGG - Intergenic
1053496211 9:38549958-38549980 GCCCCTGTGGCTGCTCTCATGGG - Intronic
1053497951 9:38562313-38562335 AGCCCCGTGGCTGCTCTCATGGG - Intronic
1053616340 9:39770308-39770330 GCCCCCATGGCTGCTTTCACAGG + Intergenic
1053663671 9:40302105-40302127 GCCCCCATGGCTGCTCTCATGGG + Intronic
1053666016 9:40318087-40318109 GCCCCCATGGCTGCTGTCATGGG + Intronic
1053877870 9:42562015-42562037 GCCCCAGTGACTGCTTCCATGGG - Intergenic
1053894786 9:42732351-42732373 GCCCCAGTGACTGCTTCCATGGG + Intergenic
1053914184 9:42932647-42932669 GCCCCCATGGCTGCTCTCATGGG + Intergenic
1053915595 9:42943132-42943154 GCCCCCATGGCTGCTGTCATGGG + Intergenic
1054233825 9:62539679-62539701 GCCCCAGTGACTGCTTCCATGGG + Intergenic
1054237177 9:62572081-62572103 GCCCCCATGGCTGCTTTCACAGG - Intergenic
1054375795 9:64448338-64448360 GCCCCCATGGCTGCTCTCATGGG + Intergenic
1054377171 9:64458115-64458137 GCCCCCATGGCTGCTGTCATGGG + Intergenic
1054518594 9:66058196-66058218 GCCCCCATGGCTGCTGTCATGGG - Intergenic
1054520944 9:66074180-66074202 GCCCCCATGGCTGCTCTCATGGG - Intergenic
1054551313 9:66606592-66606614 GCCCCCATGGCTGCTTTCACAGG - Intergenic
1055180437 9:73380241-73380263 GCCCCTATGGCTTCTTTCACAGG + Intergenic
1055309383 9:74962867-74962889 TTTCCTCTGGCTGCTTTAATTGG - Intergenic
1055334933 9:75224002-75224024 GCCCCTGAGGCTGCTCTCATGGG + Intergenic
1055698692 9:78917556-78917578 GCCCCTGTGGCTGCTTTCACAGG - Intergenic
1055782290 9:79832755-79832777 GCCCATGTGGCTGCTCTCATGGG + Intergenic
1055858776 9:80723892-80723914 CTCCTCCTGGCTGCTTTCATGGG + Intergenic
1055884023 9:81037885-81037907 TTCCCTGGGGCTGGTTTCATAGG - Intergenic
1056192640 9:84199239-84199261 GCCCCTGTGCCTGGTCTCATAGG + Intergenic
1056670406 9:88623052-88623074 ACCCCTCTGGCTGCTCTCATGGG + Intergenic
1056701869 9:88917847-88917869 GTCCCTGTGGTTGCTTTCCTAGG - Intergenic
1057449459 9:95143826-95143848 GTCCCTGGGGCTGCCGTCATAGG - Intronic
1057676133 9:97137496-97137518 GCCCCTGTGGCTGCTCTCATGGG - Intergenic
1058160934 9:101570055-101570077 GTCCCTGTGGCTGCTTCACTTGG + Exonic
1058309781 9:103485790-103485812 GCCCCTGCGCCTGCTTTCATAGG - Intergenic
1059581695 9:115556149-115556171 CCCCCTGTGGATGCTTTCTTGGG + Intergenic
1060815225 9:126631628-126631650 GTCCCTGTGCCTGCAGTTATTGG + Intronic
1060931476 9:127492008-127492030 GTCCCTGTGTCTGTTCTCAGTGG + Intronic
1061177649 9:129007319-129007341 GTCCTTGACCCTGCTTTCATTGG + Intronic
1061820723 9:133225998-133226020 GTCCCAGTGGCTTCTCCCATGGG + Intergenic
1062010619 9:134264821-134264843 GTCCCGGGGGCTGCTTTCAGGGG + Intergenic
1062238551 9:135524068-135524090 GTCCCAGTGGCTTCTCCCATGGG - Intronic
1062669945 9:137702577-137702599 GCTCCTGCAGCTGCTTTCATGGG + Intronic
1203546514 Un_KI270743v1:132488-132510 GCCCCCATGGCTGCTCTCATGGG - Intergenic
1186053369 X:5623955-5623977 GGCCCTGTGCCTGCTTTCTCAGG - Intergenic
1187574813 X:20542766-20542788 GCCCCCGTGGCTGCTTTCACGGG - Intergenic
1187598457 X:20800501-20800523 CCCCCTCTGGCTGCTGTCATGGG - Intergenic
1187628669 X:21144081-21144103 GCTCCTGTAGCTGCTTTCATGGG + Intergenic
1188105570 X:26143804-26143826 ACCCCTGTGGTTGCTCTCATGGG + Intergenic
1188238202 X:27754326-27754348 GCCCCTGTGACTGCTATCACGGG + Intergenic
1188259655 X:28007962-28007984 GCCCCTGCAGCTGCTTTCAATGG + Intergenic
1188807800 X:34613494-34613516 GCCATTGTGGCTGCTTTCACAGG + Intergenic
1188926586 X:36051328-36051350 CCCCTTCTGGCTGCTTTCATGGG - Intronic
1189253689 X:39621002-39621024 TCCCTTCTGGCTGCTTTCATGGG + Intergenic
1189549372 X:42077370-42077392 GCCCATGTGGCTGCTCTCATGGG + Intergenic
1189669700 X:43394962-43394984 CTCCTCCTGGCTGCTTTCATGGG + Intergenic
1190121612 X:47664683-47664705 GTCCCTGAGGCTCTATTCATTGG + Intergenic
1190446689 X:50532757-50532779 GTCCTTATGGCTGCTACCATAGG + Intergenic
1190466200 X:50726976-50726998 GCCCCCATGGCTGCTTTCATGGG - Intronic
1190556631 X:51642212-51642234 GTCCCTGTGTATTCTTTCCTAGG + Intergenic
1190703547 X:53006262-53006284 GCCCCTGTGGCTGCTGTCACAGG + Intergenic
1191188623 X:57640508-57640530 TCCCTTCTGGCTGCTTTCATGGG - Intergenic
1191760940 X:64647443-64647465 GCCCCCGTGGCTGCTTTCTCAGG - Intergenic
1191923174 X:66279043-66279065 ACCCCTGTGGCTGCTCTCATTGG + Intergenic
1192071050 X:67941569-67941591 GCCCCTGTGGCTGCTTTCATAGG + Intergenic
1192723795 X:73727005-73727027 GGCTCTGTGGCTGCTTTCCAAGG - Intergenic
1193029067 X:76878758-76878780 GCCCCTGTGGCTGCTTTCATGGG + Intergenic
1193050704 X:77096437-77096459 GCCCCTGTGGCTGCTTTCATGGG - Intergenic
1193066434 X:77265153-77265175 GACCCCATGGTTGCTTTCATGGG - Intergenic
1193226013 X:78985347-78985369 GCCCCCACGGCTGCTTTCATGGG + Intergenic
1193489654 X:82133744-82133766 GCCCCAGTGGCTGCTTTCATGGG + Intergenic
1193509090 X:82377718-82377740 GCCTCCATGGCTGCTTTCATGGG + Intergenic
1193557535 X:82974865-82974887 GCTCATGTGGCTGCCTTCATGGG - Intergenic
1193770342 X:85580639-85580661 GCCCCTATGGCTGCTCTCAGAGG + Intergenic
1193795339 X:85866647-85866669 GGCACTGTGCCTGCTTTCATGGG - Intronic
1193801950 X:85946853-85946875 GCCCCTGTGGCTGCTCTCACAGG - Intronic
1193911225 X:87309258-87309280 GCCCCCTTGGCTGCTTTCACAGG + Intergenic
1194038808 X:88914918-88914940 GTCCCCATGGCTGCTTTCATGGG + Intergenic
1194093326 X:89604064-89604086 AGACCTGTGGCTGCTCTCATGGG - Intergenic
1194135038 X:90130673-90130695 GCCCCTGAGGCTCCTTTCACAGG - Intergenic
1194373953 X:93109905-93109927 GCCCCTGTTGCTACTCTCATGGG + Intergenic
1194435122 X:93860273-93860295 TCCCCTGTGGCTGCTTTCATAGG - Intergenic
1194450762 X:94042041-94042063 GTCCCCATGTCTGCCTTCATGGG - Intergenic
1194793432 X:98179926-98179948 GTCACTGTTGCTGTTGTCATGGG + Intergenic
1194843662 X:98776369-98776391 CTCCTCCTGGCTGCTTTCATTGG - Intergenic
1194855179 X:98919037-98919059 GCCCCTGCAGCTGCTCTCATGGG - Intergenic
1195035148 X:100965514-100965536 GCCTCTGTGGCTGCTCTCACGGG - Intergenic
1195510772 X:105713082-105713104 GCCCCTGTGGCTGCCTTCATGGG + Intronic
1195863765 X:109408077-109408099 TCCCTTCTGGCTGCTTTCATGGG - Intronic
1196015858 X:110939246-110939268 GCCCATGTGGCTGCTTTCATGGG - Intergenic
1196498603 X:116351174-116351196 GTCCCCATGGCTACTTTCATGGG - Intergenic
1196540339 X:116900177-116900199 TTCCTCCTGGCTGCTTTCATGGG + Intergenic
1196574396 X:117301824-117301846 ATCCCTGCTGCTGCTTTCACTGG - Intergenic
1197072309 X:122314040-122314062 GACTTTGTGGCTGCTTTCATGGG - Intergenic
1197441330 X:126494660-126494682 CTCCTTCTGGCTGCTTTCACGGG - Intergenic
1197472724 X:126882903-126882925 CTCCTTGTGGCTGCTCTCATGGG - Intergenic
1197524821 X:127548069-127548091 GTCCCCATGGCTGCTATCAAGGG - Intergenic
1197642931 X:128986418-128986440 CCCCTTCTGGCTGCTTTCATGGG - Intergenic
1198588590 X:138150153-138150175 GCCCATGTGGCTGCTCTCACAGG - Intergenic
1199062537 X:143376116-143376138 GATCTTGTGGCTGCTTTCATGGG + Intergenic
1199113223 X:143959176-143959198 TCCCTTCTGGCTGCTTTCATGGG + Intergenic
1199223465 X:145343831-145343853 GTCCCTGTGGCTGCTCTCAAGGG + Intergenic
1199237798 X:145510710-145510732 GCCTCCGTGGCTGCTCTCATGGG - Intergenic
1199330249 X:146550693-146550715 GCCTCCTTGGCTGCTTTCATGGG + Intergenic
1199373817 X:147083742-147083764 AACCCTGTAGCTGCTTTCACAGG - Intergenic
1199420393 X:147637453-147637475 CCCCTCGTGGCTGCTTTCATGGG - Intergenic
1199806443 X:151305347-151305369 GCTCCCATGGCTGCTTTCATGGG + Intergenic
1199823160 X:151471104-151471126 GACCCTGCAGCTGCTTTCATGGG + Intergenic
1200073709 X:153541132-153541154 GGCTCTCTGGCTGCTGTCATGGG - Intronic
1200480820 Y:3700764-3700786 GCCCCTGAGGCTCCTTTCACAGG - Intergenic
1200518514 Y:4179725-4179747 GTGCTTGTGGCTGCCATCATGGG + Intergenic
1200681981 Y:6223976-6223998 GCCCCTGTTGCTACTCTCATGGG + Intergenic
1201759732 Y:17523561-17523583 CTCCCTAAGGCTGCTTTCAGCGG + Intergenic
1201841822 Y:18382429-18382451 CTCCCTAAGGCTGCTTTCAGCGG - Intergenic