ID: 1082255326

View in Genome Browser
Species Human (GRCh38)
Location 11:50027548-50027570
Sequence TCTGCAGGGTACAGTCCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082255326_1082255329 -10 Left 1082255326 11:50027548-50027570 CCACAGGGACTGTACCCTGCAGA No data
Right 1082255329 11:50027561-50027583 ACCCTGCAGAGCCACAGGGATGG 0: 11
1: 137
2: 780
3: 1013
4: 1211
1082255326_1082255333 2 Left 1082255326 11:50027548-50027570 CCACAGGGACTGTACCCTGCAGA No data
Right 1082255333 11:50027573-50027595 CACAGGGATGGAGCTGCCCAAGG 0: 32
1: 253
2: 494
3: 817
4: 1322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082255326 Original CRISPR TCTGCAGGGTACAGTCCCTG TGG (reversed) Intergenic
No off target data available for this crispr