ID: 1082255333

View in Genome Browser
Species Human (GRCh38)
Location 11:50027573-50027595
Sequence CACAGGGATGGAGCTGCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2918
Summary {0: 32, 1: 253, 2: 494, 3: 817, 4: 1322}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082255325_1082255333 15 Left 1082255325 11:50027535-50027557 CCTATGAAAGCAGCCACAGGGAC 0: 4
1: 25
2: 99
3: 207
4: 617
Right 1082255333 11:50027573-50027595 CACAGGGATGGAGCTGCCCAAGG 0: 32
1: 253
2: 494
3: 817
4: 1322
1082255326_1082255333 2 Left 1082255326 11:50027548-50027570 CCACAGGGACTGTACCCTGCAGA No data
Right 1082255333 11:50027573-50027595 CACAGGGATGGAGCTGCCCAAGG 0: 32
1: 253
2: 494
3: 817
4: 1322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082255333 Original CRISPR CACAGGGATGGAGCTGCCCA AGG Intergenic
Too many off-targets to display for this crispr