ID: 1082260303

View in Genome Browser
Species Human (GRCh38)
Location 11:50072846-50072868
Sequence TGCCTCGCTGTGGCATCCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082260303_1082260319 23 Left 1082260303 11:50072846-50072868 CCCGAGGATGCCACAGCGAGGCA No data
Right 1082260319 11:50072892-50072914 TGCAAGGTGGAGGCTGGGCCTGG No data
1082260303_1082260310 -6 Left 1082260303 11:50072846-50072868 CCCGAGGATGCCACAGCGAGGCA No data
Right 1082260310 11:50072863-50072885 GAGGCAAGAGGTGGGCCTGGAGG No data
1082260303_1082260320 28 Left 1082260303 11:50072846-50072868 CCCGAGGATGCCACAGCGAGGCA No data
Right 1082260320 11:50072897-50072919 GGTGGAGGCTGGGCCTGGAGAGG No data
1082260303_1082260315 13 Left 1082260303 11:50072846-50072868 CCCGAGGATGCCACAGCGAGGCA No data
Right 1082260315 11:50072882-50072904 GAGGGCCTACTGCAAGGTGGAGG No data
1082260303_1082260321 29 Left 1082260303 11:50072846-50072868 CCCGAGGATGCCACAGCGAGGCA No data
Right 1082260321 11:50072898-50072920 GTGGAGGCTGGGCCTGGAGAGGG No data
1082260303_1082260318 18 Left 1082260303 11:50072846-50072868 CCCGAGGATGCCACAGCGAGGCA No data
Right 1082260318 11:50072887-50072909 CCTACTGCAAGGTGGAGGCTGGG No data
1082260303_1082260314 10 Left 1082260303 11:50072846-50072868 CCCGAGGATGCCACAGCGAGGCA No data
Right 1082260314 11:50072879-50072901 CTGGAGGGCCTACTGCAAGGTGG No data
1082260303_1082260316 17 Left 1082260303 11:50072846-50072868 CCCGAGGATGCCACAGCGAGGCA No data
Right 1082260316 11:50072886-50072908 GCCTACTGCAAGGTGGAGGCTGG No data
1082260303_1082260309 -9 Left 1082260303 11:50072846-50072868 CCCGAGGATGCCACAGCGAGGCA No data
Right 1082260309 11:50072860-50072882 AGCGAGGCAAGAGGTGGGCCTGG No data
1082260303_1082260312 7 Left 1082260303 11:50072846-50072868 CCCGAGGATGCCACAGCGAGGCA No data
Right 1082260312 11:50072876-50072898 GGCCTGGAGGGCCTACTGCAAGG No data
1082260303_1082260311 -5 Left 1082260303 11:50072846-50072868 CCCGAGGATGCCACAGCGAGGCA No data
Right 1082260311 11:50072864-50072886 AGGCAAGAGGTGGGCCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082260303 Original CRISPR TGCCTCGCTGTGGCATCCTC GGG (reversed) Intergenic
No off target data available for this crispr