ID: 1082263874

View in Genome Browser
Species Human (GRCh38)
Location 11:50098827-50098849
Sequence TAAGTAGGAGCTACCATGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082263874_1082263877 4 Left 1082263874 11:50098827-50098849 CCAGGCATGGTAGCTCCTACTTA No data
Right 1082263877 11:50098854-50098876 TCCAGCAATTTGGAAAGCCAAGG No data
1082263874_1082263881 27 Left 1082263874 11:50098827-50098849 CCAGGCATGGTAGCTCCTACTTA No data
Right 1082263881 11:50098877-50098899 CATGAGGATTTCTTGACGCCAGG No data
1082263874_1082263879 11 Left 1082263874 11:50098827-50098849 CCAGGCATGGTAGCTCCTACTTA No data
Right 1082263879 11:50098861-50098883 ATTTGGAAAGCCAAGGCATGAGG No data
1082263874_1082263876 -6 Left 1082263874 11:50098827-50098849 CCAGGCATGGTAGCTCCTACTTA No data
Right 1082263876 11:50098844-50098866 TACTTATAATTCCAGCAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082263874 Original CRISPR TAAGTAGGAGCTACCATGCC TGG (reversed) Intergenic
No off target data available for this crispr