ID: 1082269204

View in Genome Browser
Species Human (GRCh38)
Location 11:50151122-50151144
Sequence CAAAATAAAGGGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082269197_1082269204 8 Left 1082269197 11:50151091-50151113 CCCATATCACGAGCAGAGACACA No data
Right 1082269204 11:50151122-50151144 CAAAATAAAGGGAAGGAGGAAGG No data
1082269198_1082269204 7 Left 1082269198 11:50151092-50151114 CCATATCACGAGCAGAGACACAC No data
Right 1082269204 11:50151122-50151144 CAAAATAAAGGGAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082269204 Original CRISPR CAAAATAAAGGGAAGGAGGA AGG Intergenic
No off target data available for this crispr