ID: 1082271035

View in Genome Browser
Species Human (GRCh38)
Location 11:50169782-50169804
Sequence GGCTTCGCTTATCAGCCAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082271035_1082271042 13 Left 1082271035 11:50169782-50169804 CCCGTTGGCTGATAAGCGAAGCC No data
Right 1082271042 11:50169818-50169840 AACTCGCTGCAGTGCAGGCGGGG No data
1082271035_1082271043 17 Left 1082271035 11:50169782-50169804 CCCGTTGGCTGATAAGCGAAGCC No data
Right 1082271043 11:50169822-50169844 CGCTGCAGTGCAGGCGGGGTAGG No data
1082271035_1082271040 11 Left 1082271035 11:50169782-50169804 CCCGTTGGCTGATAAGCGAAGCC No data
Right 1082271040 11:50169816-50169838 TTAACTCGCTGCAGTGCAGGCGG No data
1082271035_1082271044 18 Left 1082271035 11:50169782-50169804 CCCGTTGGCTGATAAGCGAAGCC No data
Right 1082271044 11:50169823-50169845 GCTGCAGTGCAGGCGGGGTAGGG No data
1082271035_1082271039 8 Left 1082271035 11:50169782-50169804 CCCGTTGGCTGATAAGCGAAGCC No data
Right 1082271039 11:50169813-50169835 TATTTAACTCGCTGCAGTGCAGG No data
1082271035_1082271045 19 Left 1082271035 11:50169782-50169804 CCCGTTGGCTGATAAGCGAAGCC No data
Right 1082271045 11:50169824-50169846 CTGCAGTGCAGGCGGGGTAGGGG No data
1082271035_1082271041 12 Left 1082271035 11:50169782-50169804 CCCGTTGGCTGATAAGCGAAGCC No data
Right 1082271041 11:50169817-50169839 TAACTCGCTGCAGTGCAGGCGGG No data
1082271035_1082271046 22 Left 1082271035 11:50169782-50169804 CCCGTTGGCTGATAAGCGAAGCC No data
Right 1082271046 11:50169827-50169849 CAGTGCAGGCGGGGTAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082271035 Original CRISPR GGCTTCGCTTATCAGCCAAC GGG (reversed) Intergenic
No off target data available for this crispr