ID: 1082271038

View in Genome Browser
Species Human (GRCh38)
Location 11:50169804-50169826
Sequence CAGCGAGTTAAATATGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082271038_1082271043 -5 Left 1082271038 11:50169804-50169826 CCTGTTTCATATTTAACTCGCTG No data
Right 1082271043 11:50169822-50169844 CGCTGCAGTGCAGGCGGGGTAGG No data
1082271038_1082271047 19 Left 1082271038 11:50169804-50169826 CCTGTTTCATATTTAACTCGCTG No data
Right 1082271047 11:50169846-50169868 GTGGAGATGCGTCGTTTATAAGG No data
1082271038_1082271044 -4 Left 1082271038 11:50169804-50169826 CCTGTTTCATATTTAACTCGCTG No data
Right 1082271044 11:50169823-50169845 GCTGCAGTGCAGGCGGGGTAGGG No data
1082271038_1082271042 -9 Left 1082271038 11:50169804-50169826 CCTGTTTCATATTTAACTCGCTG No data
Right 1082271042 11:50169818-50169840 AACTCGCTGCAGTGCAGGCGGGG No data
1082271038_1082271045 -3 Left 1082271038 11:50169804-50169826 CCTGTTTCATATTTAACTCGCTG No data
Right 1082271045 11:50169824-50169846 CTGCAGTGCAGGCGGGGTAGGGG No data
1082271038_1082271046 0 Left 1082271038 11:50169804-50169826 CCTGTTTCATATTTAACTCGCTG No data
Right 1082271046 11:50169827-50169849 CAGTGCAGGCGGGGTAGGGGTGG No data
1082271038_1082271048 20 Left 1082271038 11:50169804-50169826 CCTGTTTCATATTTAACTCGCTG No data
Right 1082271048 11:50169847-50169869 TGGAGATGCGTCGTTTATAAGGG No data
1082271038_1082271049 21 Left 1082271038 11:50169804-50169826 CCTGTTTCATATTTAACTCGCTG No data
Right 1082271049 11:50169848-50169870 GGAGATGCGTCGTTTATAAGGGG No data
1082271038_1082271041 -10 Left 1082271038 11:50169804-50169826 CCTGTTTCATATTTAACTCGCTG No data
Right 1082271041 11:50169817-50169839 TAACTCGCTGCAGTGCAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082271038 Original CRISPR CAGCGAGTTAAATATGAAAC AGG (reversed) Intergenic
No off target data available for this crispr