ID: 1082271042

View in Genome Browser
Species Human (GRCh38)
Location 11:50169818-50169840
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082271038_1082271042 -9 Left 1082271038 11:50169804-50169826 CCTGTTTCATATTTAACTCGCTG No data
Right 1082271042 11:50169818-50169840 AACTCGCTGCAGTGCAGGCGGGG No data
1082271036_1082271042 12 Left 1082271036 11:50169783-50169805 CCGTTGGCTGATAAGCGAAGCCC No data
Right 1082271042 11:50169818-50169840 AACTCGCTGCAGTGCAGGCGGGG No data
1082271037_1082271042 -8 Left 1082271037 11:50169803-50169825 CCCTGTTTCATATTTAACTCGCT No data
Right 1082271042 11:50169818-50169840 AACTCGCTGCAGTGCAGGCGGGG No data
1082271035_1082271042 13 Left 1082271035 11:50169782-50169804 CCCGTTGGCTGATAAGCGAAGCC No data
Right 1082271042 11:50169818-50169840 AACTCGCTGCAGTGCAGGCGGGG No data
1082271034_1082271042 16 Left 1082271034 11:50169779-50169801 CCTCCCGTTGGCTGATAAGCGAA No data
Right 1082271042 11:50169818-50169840 AACTCGCTGCAGTGCAGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082271042 Original CRISPR AACTCGCTGCAGTGCAGGCG GGG Intergenic
No off target data available for this crispr