ID: 1082273774

View in Genome Browser
Species Human (GRCh38)
Location 11:50199892-50199914
Sequence TTATGGGTATGGAGCCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082273774_1082273780 3 Left 1082273774 11:50199892-50199914 CCATCTTGGCTCCATACCCATAA No data
Right 1082273780 11:50199918-50199940 CATTTTGATTGGCTGAGACATGG No data
1082273774_1082273777 -8 Left 1082273774 11:50199892-50199914 CCATCTTGGCTCCATACCCATAA No data
Right 1082273777 11:50199907-50199929 ACCCATAATGGCATTTTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082273774 Original CRISPR TTATGGGTATGGAGCCAAGA TGG (reversed) Intergenic
No off target data available for this crispr