ID: 1082282826

View in Genome Browser
Species Human (GRCh38)
Location 11:50288494-50288516
Sequence AAGGAGAAGCAGGATGATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082282826_1082282833 13 Left 1082282826 11:50288494-50288516 CCATTATCATCCTGCTTCTCCTT No data
Right 1082282833 11:50288530-50288552 CCTACTCATCCTCATGACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082282826 Original CRISPR AAGGAGAAGCAGGATGATAA TGG (reversed) Intergenic
No off target data available for this crispr