ID: 1082282833

View in Genome Browser
Species Human (GRCh38)
Location 11:50288530-50288552
Sequence CCTACTCATCCTCATGACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082282826_1082282833 13 Left 1082282826 11:50288494-50288516 CCATTATCATCCTGCTTCTCCTT No data
Right 1082282833 11:50288530-50288552 CCTACTCATCCTCATGACACTGG No data
1082282824_1082282833 17 Left 1082282824 11:50288490-50288512 CCCTCCATTATCATCCTGCTTCT No data
Right 1082282833 11:50288530-50288552 CCTACTCATCCTCATGACACTGG No data
1082282825_1082282833 16 Left 1082282825 11:50288491-50288513 CCTCCATTATCATCCTGCTTCTC No data
Right 1082282833 11:50288530-50288552 CCTACTCATCCTCATGACACTGG No data
1082282829_1082282833 3 Left 1082282829 11:50288504-50288526 CCTGCTTCTCCTTGGCCTGGCTA No data
Right 1082282833 11:50288530-50288552 CCTACTCATCCTCATGACACTGG No data
1082282830_1082282833 -6 Left 1082282830 11:50288513-50288535 CCTTGGCCTGGCTAATTCCTACT No data
Right 1082282833 11:50288530-50288552 CCTACTCATCCTCATGACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082282833 Original CRISPR CCTACTCATCCTCATGACAC TGG Intergenic
No off target data available for this crispr