ID: 1082283018

View in Genome Browser
Species Human (GRCh38)
Location 11:50290995-50291017
Sequence CATACTTTGTAGAGGGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082283014_1082283018 -9 Left 1082283014 11:50290981-50291003 CCATGCATGCAGTTCATACTTTG No data
Right 1082283018 11:50290995-50291017 CATACTTTGTAGAGGGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082283018 Original CRISPR CATACTTTGTAGAGGGAGGT AGG Intergenic
No off target data available for this crispr